View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_57 (Length: 203)
Name: NF19236_low_57
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 184
Target Start/End: Original strand, 47575736 - 47575901
Alignment:
| Q |
19 |
aaagggcacgaattgtagtagtattaannnnnnngggtaaaaaacgcgtttttaattaatttaccttgatatggtttatgttttcatcgtagctgttggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
47575736 |
aaagggcacgaattgtagtagtattaatttttttgggtaaaaaacgcgtttttaattaattcaccttgatatggtttatgcattcatcgaagctgttggt |
47575835 |
T |
 |
| Q |
119 |
tcttctaaatgatgtggatcacacggtgttgtttgtttggacagtggatcgactactgggttataa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47575836 |
tcttctaaatgatgtggatcacacggtgttgtttgtttggacagtggatcgactactgggttataa |
47575901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University