View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19237_high_6 (Length: 251)
Name: NF19237_high_6
Description: NF19237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19237_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 48 - 232
Target Start/End: Original strand, 42903282 - 42903470
Alignment:
| Q |
48 |
ctcacttattacaatatttactnnnnnnn-ggtcaatatattaatctttcaggctcccataatgacctaacacttccttgnnnnnnn---aaccaacatt |
143 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42903282 |
ctcacttattacaatatttactaaaaaaaaggtcaatatattaatctttcaggctcccataatgacctaacacttccttgtattttttttaaccaacatt |
42903381 |
T |
 |
| Q |
144 |
aatcaaattactacatcaattataacaggtggcaaaccggcgttggccccatccgagagacctgtttaacctgtcattttagacgtgcc |
232 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||| |||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
42903382 |
aatcaaattactacatcaactataacatgtggcaaaccggtgttagccctatccaacagacctgtttaacctgtcattttagacgtgcc |
42903470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University