View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19237_low_6 (Length: 272)
Name: NF19237_low_6
Description: NF19237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19237_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 4813344 - 4813598
Alignment:
| Q |
1 |
cacgagttgtaggatatttttcataaagaggagctgatgtggttccaacgctctagagaaaaatggcttatttgcggtgataggaatactcgatattacc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4813344 |
cacgagttgtaggatattcttcataaagaggagctgatgtggttccaacgctctagagaaaaatggcttattagcggtgataggaatactcaatattacc |
4813443 |
T |
|
| Q |
101 |
atttaaaagttgataataggaaaagg-aaaataatgtttcgctgcttggtaaggatcaaggtgattggggttgaggatacaagtcatggttaatgatttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4813444 |
atttaaaagttgataataggaaaaggaaaaataatgtttcgctgcttcgtaaggatcaaggtgattggggttgaggatacaagtcatggttaatgatttt |
4813543 |
T |
|
| Q |
200 |
tataaaaacttattcacagaatcatgtggagaaaatggagcggctggggtctggg |
254 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4813544 |
tataaaatcttattcacagaaccatgtggagaaaatggagcggctggggtctggg |
4813598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University