View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19238_high_11 (Length: 275)
Name: NF19238_high_11
Description: NF19238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19238_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 967891 - 968132
Alignment:
| Q |
19 |
gtatatacaaacatttatattcatatattaatnnnnnnnntata--gtcaaaatagattatgtaaataatacacatggtgatacttactttggaacaaat |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
967891 |
gtatatacaaacatttatatttatatattaataaaaaaaatatatagtcaaaatagattatgtaaataatacacatgatgatacttactttggaacaaat |
967990 |
T |
|
| Q |
117 |
ggaataatagttattgattcattacttttttagaaaccttaaacaactaccctttaaacacttgctagcaaatatattacccttatagtttcagccaatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
967991 |
ggaataatagttattgattcattacttttttagaaactttaaacaaccaccctttaaacacttgctagcaaatatattacccttatagtttcagccaatt |
968090 |
T |
|
| Q |
217 |
gaaatttaattgtctaattttaattcaatgggtgagattatt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
968091 |
gaaatttaattgtctaattttaattcaatgggtgagattatt |
968132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University