View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19238_high_16 (Length: 231)
Name: NF19238_high_16
Description: NF19238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19238_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 7724640 - 7724444
Alignment:
| Q |
19 |
aatgattacacttttcctaagcattgtgattcagatcctgaagatcaagaacatgaatactgtcactgatgaaatctaatttgctattcgttcccaaacc |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724640 |
aatgattacacctttcctaagcattgtgattcagatcctgaagatcaagaacatgaatactgtcactgatgaaatctaatttgctattcgttcccaaacc |
7724541 |
T |
 |
| Q |
119 |
acgctgcatagatctattccattgagcttaggagtagccgtaacagcatagaaaccttcattgggatgaacaaagaaagttgattcattattaggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724540 |
acgctgcatagatctattccattgagcttaggagtagccgtaacagcatagaaaccatcattgggatgaacaaagaaagttgattcattattaggat |
7724444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 77
Target Start/End: Complemental strand, 20071536 - 20071496
Alignment:
| Q |
37 |
aagcattgtgattcagatcctgaagatcaagaacatgaata |
77 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
20071536 |
aagcattgtgattcagatcatgaagatcaggaacaagaata |
20071496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University