View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19238_high_9 (Length: 306)
Name: NF19238_high_9
Description: NF19238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19238_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 47100611 - 47100462
Alignment:
| Q |
1 |
attggacaataactatagtaccagtggagtgcagtgtgggggactatttgctatcggctatggtgttggcggaataaacgggtgcatgatccaaatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100611 |
attggacaataactatagtaccagtggagtgcagtgtgggggactatttgctatcggctatggtgttggcggaataaacgggtgcatgatccaaatttgt |
47100512 |
T |
 |
| Q |
101 |
taggccttttaaaccgtggtgccatatttttaacttactgcaattttcca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100511 |
taggccttttaaaccgtggtgccatatttttaacttactgcaattttcca |
47100462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 148 - 288
Target Start/End: Complemental strand, 47100429 - 47100289
Alignment:
| Q |
148 |
ccaggatcatcatatgataatagaagcttgatgcatgtgtcttggaaggctcaaccaagtggttggcattgtctaaatatagatggtgcagccaagataa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100429 |
ccaggatcatcatatgataatagaagcttgatgcatgtgtcttggaaggctccaccaagtggttggcattgtctaaatatagatggtgcagccaagataa |
47100330 |
T |
 |
| Q |
248 |
ctaataaagtagcatgttatggtggagttttacgtgatgat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100329 |
ctaataaagtagcatgttatggtggagttttacgtgatgat |
47100289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University