View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_high_31 (Length: 262)
Name: NF19239_high_31
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 4035229 - 4035114
Alignment:
| Q |
137 |
ggtttgcgaagtgaagtgagaagtgatttgagtttataaaagtgaagggacccacattggctcccgtaattgtcggctggccggcaccactacaatacta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4035229 |
ggtttgcgaagtgaagtgagaagtgatttgagtttataaaagtgaagggacccacattggctcccgtaattgtcggctggccggcaccactacaatacta |
4035130 |
T |
 |
| Q |
237 |
ctactaccaccctttg |
252 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4035129 |
ctactaccaccctttg |
4035114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 4035347 - 4035293
Alignment:
| Q |
19 |
gtagcgtccccatggtcgcttcctaacacctctgtagtgtccttcacgattcgct |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4035347 |
gtagcgtccccatggtcgcttcctaacacctctgtagtgtccttcacgattcgct |
4035293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University