View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_high_34 (Length: 251)
Name: NF19239_high_34
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 2295041 - 2295284
Alignment:
| Q |
1 |
ttaagaagcaccaccaaatatgccgagtccgtttttggccagctaagtacctagtcacaatatcatataaacattgacaataagctcaaa--atagaaga |
98 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2295041 |
ttaagaatcaccacctaatatgccgagtccgtttttggccagctaagtacctagtcacaatatcatataaacattgacaataagctcaaaatatagaaga |
2295140 |
T |
|
| Q |
99 |
taaatcataca-ttttttcccactgtttctctcaattttccttttatatgatc---aaacatatatt-atatactataaacccttcttcatttgattcca |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||| ||||||| |||||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
2295141 |
taaatcatacatttttttcccactgtttctctcaatttcccttttttatgatccatcaacatatattaatatactataaccccttctttatttgattcca |
2295240 |
T |
|
| Q |
194 |
aattaccactacacacaagnnnnnnnntgaccaagatctttgtg |
237 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
2295241 |
aattactactacacacaagaaaaaaaatgaccaagatctttgtg |
2295284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University