View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_high_39 (Length: 237)
Name: NF19239_high_39
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 54498499 - 54498274
Alignment:
| Q |
1 |
gatccggtagcaacgctacaacaattatttcttgtcaacgtgaaacaacatcagattggggatctacattcagttcattcgcaactaatgtgattgtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498499 |
gatccggtagcaacgctacaacaattatttctagtcaacgtgaaacaacatcagattggggatctacattcagttcattcgcaactaatgtgattgtgag |
54498400 |
T |
 |
| Q |
101 |
tgacattactttcaaggtaaaatcaagaaaaatcaatacaannnnnnnnnnngatatctctcccatatttgtatttagttaatataaca----gattatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54498399 |
tgacattactttcaaggtaaaatcaagaaaaatcaatacaa-ttttttttttgatatctctcccatatttgtatttagttaatataacacattaattatt |
54498301 |
T |
 |
| Q |
197 |
gtatgattgcagaactcatataatttg |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
54498300 |
gtatgattgcagaactcatataatttg |
54498274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University