View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19239_high_42 (Length: 218)

Name: NF19239_high_42
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19239_high_42
NF19239_high_42
[»] chr4 (2 HSPs)
chr4 (90-201)||(39932979-39933088)
chr4 (19-69)||(39933110-39933158)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 90 - 201
Target Start/End: Complemental strand, 39933088 - 39932979
Alignment:
90 agctcttcactcagaaacctatctcttaaaatgttatttttactgcactgtattaattgtcttttactgaatgtgaatttcacttttgttagttgttagc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||||||||    
39933088 agctcttcactcagaaacctatctcttaaaatgttatttttactgc--tgtattaattgtcttttactgaatgtgaatttcagttttgttagttgttagc 39932991  T
190 atatttggcctt 201  Q
    ||||||||||||    
39932990 atatttggcctt 39932979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 39933158 - 39933110
Alignment:
19 tctatgcccatgttaaatatttgtttcttctttctgttttagacaatggaa 69  Q
    ||||||||||||||||||||||||||||||  |||||||||||||||||||    
39933158 tctatgcccatgttaaatatttgtttcttc--tctgttttagacaatggaa 39933110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University