View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_high_42 (Length: 218)
Name: NF19239_high_42
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 90 - 201
Target Start/End: Complemental strand, 39933088 - 39932979
Alignment:
| Q |
90 |
agctcttcactcagaaacctatctcttaaaatgttatttttactgcactgtattaattgtcttttactgaatgtgaatttcacttttgttagttgttagc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39933088 |
agctcttcactcagaaacctatctcttaaaatgttatttttactgc--tgtattaattgtcttttactgaatgtgaatttcagttttgttagttgttagc |
39932991 |
T |
 |
| Q |
190 |
atatttggcctt |
201 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39932990 |
atatttggcctt |
39932979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 39933158 - 39933110
Alignment:
| Q |
19 |
tctatgcccatgttaaatatttgtttcttctttctgttttagacaatggaa |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39933158 |
tctatgcccatgttaaatatttgtttcttc--tctgttttagacaatggaa |
39933110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University