View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_13 (Length: 482)
Name: NF19239_low_13
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_13 |
 |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 5332458 - 5332234
Alignment:
| Q |
16 |
atggggaaggaaaagaactccgagtcatcctcatccatgcctaatcttacctcgggaacaatatctccttcgctgcaacaaagtattacatgaatttagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5332458 |
atggggaaggaaaagaactccgagtcatcctcatccatgcctaatcttacctcgggaacaatatctccttcgctgcaacaaagtattacatgaatttagt |
5332359 |
T |
 |
| Q |
116 |
ttcaagtcgcacatttactttagatttatatgcattgtccttattagctgagccaagctcacgaggacgcatttttgtttataatgtagagcttgcatga |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5332358 |
ttcaagtcgcacatttactttaaatttatatgcattgtccttattagttgagctaagctcacgaggacgcatttttgtttataatgtagagcttacatga |
5332259 |
T |
 |
| Q |
216 |
ctacatagaattgaattgaaggact |
240 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
5332258 |
ctacatagaattgaattgagggact |
5332234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 344 - 482
Target Start/End: Complemental strand, 5332130 - 5331992
Alignment:
| Q |
344 |
tagtggatccgcatccgcagctgtttgatccagaaccagaacgggatccagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacga |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5332130 |
tagtggatccgcatccgcagctgtttgatccagaaccagaacgggatccagatccggaaccagatccagaactaatatcggaatttgtaaggattcacga |
5332031 |
T |
 |
| Q |
444 |
catattcttaagtttcaagggggaggatactcgttcttc |
482 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
5332030 |
catattcttaagtttcaggggggaggatactcattcttc |
5331992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 400 - 482
Target Start/End: Complemental strand, 5264545 - 5264463
Alignment:
| Q |
400 |
gaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttc |
482 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||| ||| | ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5264545 |
gaaccagatccagaagcaatatcagaatttgtaaggattcatgacgtgttcttaagtttcaggggagaggatactcgttcttc |
5264463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 482
Target Start/End: Original strand, 5360712 - 5360806
Alignment:
| Q |
388 |
gatccagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttc |
482 |
Q |
| |
|
||||| |||||| || || ||||| ||| |||||| |||| | || ||||||||||| | ||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
5360712 |
gatcctgatccgaaatcatatccagaaccaatatcagaatctatagggattcacgacgtgttcttaagttttaggggagaggatactcgttcttc |
5360806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 392 - 482
Target Start/End: Original strand, 5394143 - 5394233
Alignment:
| Q |
392 |
cagatccggaaccagatccaaaactaatatcggaatttgtaaggattcacgacatattcttaagtttcaagggggaggatactcgttcttc |
482 |
Q |
| |
|
|||| ||||| ||||| ||||||||| | ||||| ||||||||||||||| | ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5394143 |
cagacccggatccagaatcaaaactaaaaccggaacgagtaaggattcacgacgtgttcttaagtttcagaggggaggacactcgttcttc |
5394233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 5264593 - 5264546
Alignment:
| Q |
16 |
atggggaaggaaaagaactccgagtcatcctcatccatgcctaatctt |
63 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
5264593 |
atggggaaggaaaaacaatccgagtcttcctcatccatgcctaatctt |
5264546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 3984 - 4045
Alignment:
| Q |
16 |
atggggaaggaaaagaactccgagtcatcctcatccatgcctaatcttacctcgggaacaat |
77 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
3984 |
atggggaaggaaaagaactccgagtcttcctcatccatgcctaatcttaccaggggaacaat |
4045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 22589627 - 22589567
Alignment:
| Q |
16 |
atggggaaggaaaagaactccgagtcatcctcatccatgcctaatcttacctcgggaacaa |
76 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
22589627 |
atggggaatgaaaagaactccgagtcttcctcatccatgcctaatcttacctggggaacaa |
22589567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 1861837 - 1861877
Alignment:
| Q |
144 |
tatgcattgtccttattagctgagccaagctcacgaggacg |
184 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
1861837 |
tatgcattgtccatatcagctgagctaagctcacgaggacg |
1861877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 27449473 - 27449513
Alignment:
| Q |
144 |
tatgcattgtccttattagctgagccaagctcacgaggacg |
184 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
27449473 |
tatgcattgtccatattaactgagctaagctcacgaggacg |
27449513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University