View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_17 (Length: 404)
Name: NF19239_low_17
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 105 - 404
Target Start/End: Original strand, 28410096 - 28410393
Alignment:
| Q |
105 |
atggaagaacatctctaatgaatgacattgatagtatgtgaatagttttgtaagtgttgtttaaactttataaagtctctaatccacaagtttaactcac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28410096 |
atggaagaacatctctaatgaatgacattgatagtatgggaatagttttgtaagtgttgtttaaacttta--aagtctctaatccacaagtttaactcac |
28410193 |
T |
 |
| Q |
205 |
ctagattttttaatgtcggtacgaagtggttggagtattttgtcaaaatggtttgacttaatttgtgtgaatttaatgaaaggtcccacaacagaagcca |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28410194 |
ctagattttttaatgtcggtacgaagtggttggagtattttgtcaaaatggtttgacttaatttgtgtgaatttaatgaaagggcccacaacagaagcca |
28410293 |
T |
 |
| Q |
305 |
taaaaagcaagcagcgattcgtatgagaaaattaagaaaagcgtgttactttcgaaatggcgttggcgtgtctctgttattcttctgaatgcttcttgct |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28410294 |
taaaaagcaagcagcgattcgtatgagaaaattaagaaaagcgtgttactttcgaaatggcgttggcgtgtctctgttattcttctgaatgcttcttgct |
28410393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University