View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_25 (Length: 343)
Name: NF19239_low_25
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 37061325 - 37060999
Alignment:
| Q |
1 |
tccggtgagggagttcgaagcgaggattaatattcggagttgtggtaacgcggtgagcgacggtgggattgttccggcgagttggttgtgactgagatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37061325 |
tccggtgagggagttcgaagcgaggattaatattcggagttgtggtaacgcggtgagcgacggtgggattgttccggcgagttggttgtgactgagatcg |
37061226 |
T |
|
| Q |
101 |
agtgtgtggagatttgtgagagaggagaatgtggcgggaatggtgccggtgaagcggttgttggggagggagatgacacggaggttggtgagttgagcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37061225 |
agtgtgtggagatttgtgagagaggagaatgtggcgggaatggtgccggtgaagcggttgttggggagggagatgacacggaggttggtgagttgagcga |
37061126 |
T |
|
| Q |
201 |
gctgaggtgggatggaaccagttacgattccgggggagagtatgagctgggttaactcggtgagggaggagatggaggaggggagtgagccggcgagggg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37061125 |
gctgaggtgggatggaaccagttacgattccgggggagagtatgagctgggttaactcggtgagggaggagatggaggaggggagtgagccggcgagggg |
37061026 |
T |
|
| Q |
301 |
gtgtctgtcgataccgagtgagagaat |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37061025 |
gtgtctgtcgataccgagtgagagaat |
37060999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University