View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19239_low_27 (Length: 331)

Name: NF19239_low_27
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19239_low_27
NF19239_low_27
[»] chr7 (72 HSPs)
chr7 (16-250)||(38578866-38579101)
chr7 (124-251)||(48804666-48804794)
chr7 (126-252)||(13095843-13095970)
chr7 (124-252)||(10047873-10048002)
chr7 (124-252)||(17748379-17748508)
chr7 (124-252)||(43861969-43862098)
chr7 (124-252)||(42210259-42210388)
chr7 (124-252)||(1605924-1606053)
chr7 (124-252)||(22993364-22993493)
chr7 (125-251)||(4195200-4195327)
chr7 (124-248)||(18785652-18785777)
chr7 (124-252)||(22973950-22974079)
chr7 (124-251)||(34659209-34659337)
chr7 (127-252)||(5069812-5069938)
chr7 (124-252)||(1797443-1797572)
chr7 (124-252)||(16802106-16802235)
chr7 (124-252)||(47341859-47341988)
chr7 (124-251)||(42032079-42032207)
chr7 (124-251)||(43346777-43346905)
chr7 (127-250)||(3353411-3353534)
chr7 (124-250)||(27028262-27028389)
chr7 (124-244)||(4228759-4228877)
chr7 (124-251)||(39474922-39475051)
chr7 (124-251)||(21190778-21190906)
chr7 (130-249)||(27875088-27875208)
chr7 (126-252)||(39420823-39420949)
chr7 (124-249)||(26423288-26423413)
chr7 (126-251)||(36619252-36619378)
chr7 (124-252)||(14650300-14650429)
chr7 (124-252)||(21530731-21530860)
chr7 (163-251)||(8734684-8734772)
chr7 (126-243)||(28396166-28396284)
chr7 (164-250)||(41945497-41945583)
chr7 (124-245)||(45960007-45960128)
chr7 (166-252)||(48551883-48551969)
chr7 (139-252)||(49142666-49142780)
chr7 (134-251)||(45697188-45697305)
chr7 (124-251)||(43925495-43925623)
chr7 (124-250)||(37514904-37515031)
chr7 (126-252)||(48244353-48244480)
chr7 (133-245)||(5039422-5039535)
chr7 (131-251)||(10317744-10317864)
chr7 (124-241)||(19914711-19914828)
chr7 (116-252)||(23658154-23658291)
chr7 (131-250)||(365130-365250)
chr7 (141-252)||(29151940-29152052)
chr7 (126-250)||(29805439-29805563)
chr7 (139-250)||(22573811-22573922)
chr7 (182-252)||(24983415-24983486)
chr7 (137-250)||(3603349-3603467)
chr7 (163-252)||(28744185-28744274)
chr7 (152-252)||(32823254-32823355)
chr7 (126-251)||(24969324-24969448)
chr7 (124-247)||(14535274-14535398)
chr7 (196-251)||(34127643-34127698)
chr7 (124-242)||(45447953-45448072)
chr7 (267-313)||(38578796-38578842)
chr7 (187-252)||(32768984-32769049)
chr7 (182-247)||(38988942-38989006)
chr7 (139-245)||(9813974-9814077)
chr7 (124-251)||(22268039-22268155)
chr7 (124-229)||(4973130-4973236)
chr7 (175-252)||(45758322-45758397)
chr7 (163-250)||(4705983-4706070)
chr7 (140-226)||(30827291-30827378)
chr7 (186-241)||(41267932-41267987)
chr7 (163-250)||(23060702-23060787)
chr7 (124-251)||(48224729-48224856)
chr7 (191-245)||(9685778-9685832)
chr7 (124-173)||(34127696-34127746)
chr7 (186-252)||(39230545-39230611)
chr7 (124-172)||(11607114-11607162)
[»] chr6 (52 HSPs)
chr6 (124-252)||(21898632-21898761)
chr6 (124-251)||(5253221-5253349)
chr6 (124-250)||(29333138-29333264)
chr6 (124-252)||(6606094-6606223)
chr6 (124-252)||(12606414-12606543)
chr6 (124-252)||(30788850-30788977)
chr6 (131-251)||(3601075-3601196)
chr6 (124-252)||(8611971-8612100)
chr6 (124-252)||(8932645-8932774)
chr6 (124-252)||(8944111-8944240)
chr6 (124-252)||(12635798-12635927)
chr6 (124-252)||(14107355-14107484)
chr6 (126-252)||(19089484-19089611)
chr6 (166-252)||(9633622-9633708)
chr6 (124-252)||(13468917-13469046)
chr6 (124-251)||(13036002-13036130)
chr6 (124-252)||(29444762-29444891)
chr6 (124-251)||(34954617-34954745)
chr6 (124-252)||(3587942-3588071)
chr6 (124-250)||(8938695-8938822)
chr6 (124-245)||(2271307-2271427)
chr6 (152-252)||(5029829-5029930)
chr6 (124-251)||(10311467-10311595)
chr6 (124-250)||(9179735-9179862)
chr6 (124-249)||(11142587-11142713)
chr6 (186-252)||(14783417-14783483)
chr6 (142-250)||(13391289-13391397)
chr6 (124-252)||(13584443-13584576)
chr6 (140-249)||(8149797-8149906)
chr6 (163-251)||(31129201-31129289)
chr6 (187-252)||(14326045-14326110)
chr6 (187-252)||(14419055-14419120)
chr6 (182-251)||(30410488-30410557)
chr6 (165-245)||(17114901-17114981)
chr6 (162-240)||(8888905-8888983)
chr6 (124-243)||(15643840-15643954)
chr6 (126-250)||(24671865-24671990)
chr6 (124-216)||(9147285-9147378)
chr6 (162-250)||(10396496-10396584)
chr6 (163-250)||(9366423-9366509)
chr6 (164-249)||(32157167-32157252)
chr6 (140-216)||(19230592-19230668)
chr6 (163-250)||(33859318-33859405)
chr6 (127-241)||(5332992-5333106)
chr6 (186-252)||(21167422-21167488)
chr6 (127-242)||(33939998-33940114)
chr6 (165-240)||(374983-375058)
chr6 (196-251)||(5759660-5759715)
chr6 (196-250)||(3030642-3030696)
chr6 (199-248)||(4596181-4596230)
chr6 (223-252)||(13116127-13116156)
chr6 (207-252)||(21872971-21873016)
[»] chr4 (98 HSPs)
chr4 (124-250)||(7246645-7246772)
chr4 (124-251)||(38166012-38166140)
chr4 (124-250)||(29895772-29895899)
chr4 (124-252)||(53599045-53599174)
chr4 (124-251)||(47078443-47078571)
chr4 (126-251)||(5472846-5472972)
chr4 (124-251)||(55921019-55921147)
chr4 (124-250)||(42722576-42722703)
chr4 (127-244)||(8889010-8889128)
chr4 (127-248)||(295534-295655)
chr4 (124-252)||(36145212-36145341)
chr4 (124-252)||(49260662-49260791)
chr4 (124-251)||(3159467-3159595)
chr4 (124-251)||(24166435-24166563)
chr4 (124-252)||(36262764-36262891)
chr4 (124-251)||(38075418-38075546)
chr4 (124-252)||(1940774-1940900)
chr4 (124-250)||(2559292-2559419)
chr4 (127-249)||(40780861-40780984)
chr4 (124-250)||(43468332-43468459)
chr4 (124-251)||(52950067-52950195)
chr4 (124-222)||(1446811-1446910)
chr4 (124-252)||(20128294-20128423)
chr4 (124-252)||(38168242-38168370)
chr4 (130-251)||(47682380-47682501)
chr4 (152-251)||(16450313-16450413)
chr4 (124-250)||(27248413-27248538)
chr4 (124-251)||(48015071-48015199)
chr4 (124-250)||(43458598-43458725)
chr4 (124-249)||(13073523-13073649)
chr4 (141-250)||(14124018-14124128)
chr4 (124-250)||(15839934-15840060)
chr4 (124-251)||(6779196-6779324)
chr4 (163-251)||(17080068-17080156)
chr4 (124-238)||(20532420-20532535)
chr4 (138-251)||(16645117-16645231)
chr4 (152-252)||(4738631-4738732)
chr4 (124-248)||(21429286-21429411)
chr4 (124-251)||(15732446-15732574)
chr4 (127-250)||(30317221-30317345)
chr4 (133-239)||(3507265-3507371)
chr4 (173-250)||(14567274-14567351)
chr4 (124-240)||(40272340-40272457)
chr4 (137-250)||(42722378-42722491)
chr4 (142-251)||(48834698-48834807)
chr4 (124-252)||(21192627-21192754)
chr4 (124-251)||(29588721-29588849)
chr4 (126-249)||(33647708-33647832)
chr4 (127-250)||(31588672-31588798)
chr4 (150-252)||(35359747-35359850)
chr4 (124-252)||(3574445-3574572)
chr4 (124-249)||(6032643-6032766)
chr4 (126-252)||(6862212-6862337)
chr4 (160-241)||(46108713-46108794)
chr4 (124-251)||(41162880-41163008)
chr4 (124-227)||(41339417-41339521)
chr4 (167-250)||(49952144-49952228)
chr4 (126-252)||(4736584-4736710)
chr4 (141-251)||(10541018-10541128)
chr4 (130-252)||(20421765-20421887)
chr4 (124-251)||(24850625-24850752)
chr4 (166-252)||(50485971-50486057)
chr4 (185-242)||(54946296-54946353)
chr4 (126-250)||(15829686-15829811)
chr4 (142-250)||(8064797-8064906)
chr4 (124-252)||(14858696-14858824)
chr4 (173-251)||(14597898-14597976)
chr4 (164-250)||(37369041-37369127)
chr4 (166-251)||(8424582-8424667)
chr4 (163-252)||(18531544-18531633)
chr4 (138-250)||(45721085-45721198)
chr4 (165-245)||(48317279-48317359)
chr4 (127-252)||(14567947-14568067)
chr4 (176-243)||(37194848-37194915)
chr4 (192-250)||(2686454-2686512)
chr4 (124-250)||(7000509-7000631)
chr4 (124-240)||(55005317-55005432)
chr4 (126-249)||(7741912-7742036)
chr4 (192-252)||(25406560-25406620)
chr4 (166-221)||(20354665-20354720)
chr4 (166-249)||(48352509-48352592)
chr4 (127-252)||(12703542-12703668)
chr4 (152-249)||(26237422-26237520)
chr4 (197-251)||(27531668-27531722)
chr4 (124-190)||(27531717-27531783)
chr4 (186-251)||(38841366-38841431)
chr4 (139-251)||(17946490-17946602)
chr4 (190-250)||(24478983-24479043)
chr4 (212-251)||(1461656-1461695)
chr4 (182-252)||(4986237-4986307)
chr4 (191-245)||(13552155-13552209)
chr4 (138-251)||(33176013-33176127)
chr4 (167-216)||(23788426-23788475)
chr4 (166-250)||(2687304-2687388)
chr4 (196-252)||(13436862-13436918)
chr4 (182-238)||(31635758-31635814)
chr4 (182-238)||(53354576-53354632)
chr4 (167-251)||(55703750-55703834)
[»] chr8 (74 HSPs)
chr8 (124-249)||(15884556-15884681)
chr8 (142-249)||(4479296-4479403)
chr8 (124-251)||(45521153-45521280)
chr8 (126-252)||(6100458-6100585)
chr8 (126-252)||(10927592-10927719)
chr8 (124-252)||(14666068-14666197)
chr8 (124-252)||(2467115-2467244)
chr8 (127-252)||(14846563-14846688)
chr8 (124-251)||(8141086-8141214)
chr8 (133-251)||(43032894-43033013)
chr8 (124-252)||(2964060-2964189)
chr8 (124-245)||(11785900-11786021)
chr8 (126-251)||(8997542-8997668)
chr8 (126-251)||(43027291-43027417)
chr8 (124-251)||(9859993-9860122)
chr8 (124-252)||(16893921-16894048)
chr8 (134-250)||(18374004-18374121)
chr8 (124-252)||(24837226-24837355)
chr8 (124-252)||(583798-583925)
chr8 (124-241)||(1012985-1013103)
chr8 (137-233)||(6042818-6042915)
chr8 (124-251)||(3418511-3418639)
chr8 (124-251)||(17981425-17981553)
chr8 (124-250)||(44893277-44893404)
chr8 (124-249)||(13085508-13085633)
chr8 (124-252)||(10535401-10535529)
chr8 (164-252)||(11298264-11298352)
chr8 (124-206)||(38922457-38922540)
chr8 (163-245)||(13357960-13358042)
chr8 (127-252)||(26570911-26571037)
chr8 (124-250)||(36662389-36662515)
chr8 (126-230)||(33401818-33401923)
chr8 (163-251)||(16291201-16291289)
chr8 (124-250)||(68097-68224)
chr8 (163-249)||(7673657-7673743)
chr8 (165-252)||(22212512-22212600)
chr8 (166-250)||(23895595-23895679)
chr8 (182-249)||(3379812-3379879)
chr8 (141-223)||(33935761-33935844)
chr8 (182-252)||(8803097-8803167)
chr8 (124-250)||(17845717-17845841)
chr8 (186-252)||(27975938-27976004)
chr8 (186-252)||(28033207-28033273)
chr8 (170-251)||(3692864-3692945)
chr8 (124-216)||(22810064-22810154)
chr8 (132-208)||(34613819-34613896)
chr8 (183-243)||(24938568-24938628)
chr8 (183-252)||(993232-993301)
chr8 (163-240)||(3567928-3568005)
chr8 (206-251)||(4772049-4772094)
chr8 (167-224)||(18091428-18091485)
chr8 (133-237)||(29933766-29933870)
chr8 (182-251)||(39969913-39969982)
chr8 (124-251)||(34710565-34710693)
chr8 (124-250)||(6940542-6940668)
chr8 (163-210)||(8586978-8587025)
chr8 (167-241)||(13831022-13831096)
chr8 (124-228)||(22958754-22958859)
chr8 (124-200)||(34846798-34846874)
chr8 (127-250)||(2209770-2209894)
chr8 (182-217)||(22276493-22276528)
chr8 (182-249)||(28738151-28738218)
chr8 (124-250)||(38235889-38236016)
chr8 (163-238)||(43349327-43349402)
chr8 (167-240)||(10698936-10699009)
chr8 (156-241)||(12754042-12754127)
chr8 (182-239)||(25848219-25848276)
chr8 (152-217)||(28333050-28333115)
chr8 (124-197)||(30903320-30903393)
chr8 (206-250)||(1653859-1653903)
chr8 (206-250)||(1742235-1742279)
chr8 (174-250)||(9395818-9395894)
chr8 (166-214)||(21174167-21174215)
chr8 (182-226)||(35496278-35496322)
[»] chr5 (93 HSPs)
chr5 (124-252)||(42086308-42086437)
chr5 (124-252)||(41163457-41163585)
chr5 (126-252)||(38897716-38897842)
chr5 (128-252)||(1538416-1538541)
chr5 (124-252)||(5731917-5732046)
chr5 (124-252)||(9812853-9812982)
chr5 (142-252)||(9805003-9805114)
chr5 (124-252)||(12704995-12705124)
chr5 (124-252)||(19572705-19572834)
chr5 (124-251)||(8513500-8513628)
chr5 (130-251)||(23383644-23383766)
chr5 (124-252)||(12766112-12766241)
chr5 (126-249)||(20525821-20525945)
chr5 (127-249)||(37263225-37263347)
chr5 (124-252)||(42861215-42861344)
chr5 (124-251)||(7866562-7866690)
chr5 (124-251)||(9168251-9168378)
chr5 (124-250)||(2485178-2485304)
chr5 (127-251)||(12081892-12082017)
chr5 (124-252)||(13664241-13664370)
chr5 (124-252)||(30349560-30349689)
chr5 (163-252)||(39099776-39099865)
chr5 (130-249)||(42291505-42291625)
chr5 (124-250)||(25417182-25417309)
chr5 (130-251)||(40117402-40117524)
chr5 (126-250)||(14588616-14588741)
chr5 (127-251)||(20682615-20682740)
chr5 (124-252)||(3653911-3654038)
chr5 (124-250)||(11845800-11845927)
chr5 (163-251)||(14728104-14728192)
chr5 (127-230)||(14974343-14974447)
chr5 (124-252)||(18136273-18136406)
chr5 (124-252)||(5079312-5079440)
chr5 (190-251)||(28857194-28857255)
chr5 (138-251)||(38369695-38369808)
chr5 (124-243)||(7308370-7308490)
chr5 (163-251)||(43399149-43399237)
chr5 (124-250)||(20692914-20693041)
chr5 (163-252)||(4016252-4016341)
chr5 (182-251)||(20255409-20255478)
chr5 (143-252)||(21375352-21375461)
chr5 (124-252)||(23247349-23247477)
chr5 (124-208)||(28857109-28857194)
chr5 (124-240)||(18294493-18294609)
chr5 (166-250)||(24463885-24463969)
chr5 (195-251)||(28857002-28857058)
chr5 (124-230)||(30995102-30995209)
chr5 (130-252)||(41800964-41801087)
chr5 (124-252)||(1898982-1899105)
chr5 (126-251)||(24653810-24653935)
chr5 (126-250)||(18045622-18045746)
chr5 (137-252)||(18262615-18262731)
chr5 (124-241)||(15034056-15034174)
chr5 (165-249)||(21487640-21487721)
chr5 (167-244)||(6764462-6764539)
chr5 (163-252)||(20590020-20590109)
chr5 (126-250)||(21149717-21149842)
chr5 (166-238)||(24875369-24875441)
chr5 (186-250)||(27648424-27648488)
chr5 (124-243)||(35813004-35813124)
chr5 (161-252)||(25452944-25453034)
chr5 (124-226)||(26077122-26077225)
chr5 (124-238)||(35561829-35561944)
chr5 (164-238)||(35245017-35245091)
chr5 (162-251)||(7616940-7617029)
chr5 (124-252)||(17693337-17693459)
chr5 (152-252)||(22655155-22655255)
chr5 (124-248)||(28862806-28862931)
chr5 (195-252)||(36783296-36783353)
chr5 (124-252)||(39728368-39728497)
chr5 (127-251)||(7336604-7336728)
chr5 (139-251)||(14152046-14152159)
chr5 (186-251)||(14235712-14235777)
chr5 (175-252)||(18327793-18327870)
chr5 (197-250)||(25950593-25950646)
chr5 (197-249)||(13887510-13887562)
chr5 (175-251)||(22295249-22295325)
chr5 (124-252)||(24498964-24499092)
chr5 (184-252)||(40773315-40773383)
chr5 (196-251)||(38296728-38296783)
chr5 (186-251)||(27484205-27484270)
chr5 (162-239)||(32874807-32874884)
chr5 (197-249)||(40060339-40060391)
chr5 (124-171)||(6767130-6767177)
chr5 (169-252)||(16757405-16757488)
chr5 (124-166)||(28856958-28857000)
chr5 (142-215)||(35006769-35006843)
chr5 (164-250)||(43212504-43212590)
chr5 (197-250)||(16755104-16755157)
chr5 (182-251)||(20228757-20228826)
chr5 (124-200)||(35403561-35403638)
chr5 (165-249)||(19839350-19839434)
chr5 (141-200)||(38297013-38297073)
[»] chr2 (93 HSPs)
chr2 (124-252)||(7747254-7747383)
chr2 (124-252)||(10823040-10823169)
chr2 (124-252)||(38005382-38005511)
chr2 (124-252)||(41220615-41220744)
chr2 (124-251)||(25540402-25540530)
chr2 (124-240)||(331481-331598)
chr2 (124-252)||(8410111-8410240)
chr2 (124-252)||(22593115-22593242)
chr2 (126-250)||(38962745-38962870)
chr2 (124-251)||(18902528-18902656)
chr2 (124-251)||(44139464-44139592)
chr2 (127-250)||(35946722-35946845)
chr2 (126-250)||(2550850-2550975)
chr2 (124-251)||(3643885-3644013)
chr2 (127-250)||(6358150-6358274)
chr2 (124-239)||(10026626-10026742)
chr2 (137-252)||(12455303-12455419)
chr2 (124-250)||(9360747-9360874)
chr2 (124-251)||(11069858-11069986)
chr2 (124-251)||(41031904-41032031)
chr2 (124-252)||(44945574-44945702)
chr2 (124-250)||(12864204-12864331)
chr2 (124-250)||(14169608-14169735)
chr2 (124-252)||(3811688-3811817)
chr2 (124-252)||(37560153-37560282)
chr2 (124-244)||(39201513-39201634)
chr2 (124-239)||(10046487-10046602)
chr2 (124-250)||(21286424-21286551)
chr2 (142-252)||(24179568-24179677)
chr2 (128-250)||(33005736-33005858)
chr2 (124-249)||(20612534-20612662)
chr2 (126-250)||(39806884-39807009)
chr2 (134-234)||(45263682-45263783)
chr2 (152-251)||(16325603-16325703)
chr2 (124-251)||(42770649-42770777)
chr2 (124-250)||(19976806-19976933)
chr2 (128-245)||(7787040-7787158)
chr2 (124-252)||(13026408-13026537)
chr2 (124-252)||(34346284-34346413)
chr2 (124-250)||(16034917-16035044)
chr2 (140-250)||(18649025-18649136)
chr2 (165-252)||(20116609-20116696)
chr2 (124-245)||(10669572-10669694)
chr2 (124-252)||(2528338-2528467)
chr2 (124-248)||(34356186-34356311)
chr2 (124-251)||(28616377-28616505)
chr2 (126-249)||(2784915-2785038)
chr2 (167-250)||(44773287-44773370)
chr2 (126-251)||(29422197-29422323)
chr2 (126-250)||(3848913-3849038)
chr2 (171-252)||(26805324-26805405)
chr2 (165-250)||(27725962-27726047)
chr2 (152-252)||(34722688-34722789)
chr2 (183-249)||(21641990-21642056)
chr2 (124-252)||(29653607-29653731)
chr2 (152-252)||(28525452-28525554)
chr2 (124-217)||(21180346-21180440)
chr2 (197-250)||(792208-792261)
chr2 (161-250)||(16813164-16813253)
chr2 (161-250)||(16852443-16852532)
chr2 (125-240)||(37804900-37805016)
chr2 (126-252)||(14853363-14853491)
chr2 (124-252)||(15234058-15234187)
chr2 (124-252)||(25549708-25549837)
chr2 (124-204)||(25604575-25604655)
chr2 (152-252)||(34130299-34130399)
chr2 (124-251)||(34738331-34738450)
chr2 (124-250)||(44193459-44193589)
chr2 (124-218)||(15079463-15079558)
chr2 (166-252)||(13104822-13104908)
chr2 (161-251)||(29421300-29421390)
chr2 (155-237)||(29697536-29697617)
chr2 (124-217)||(41187829-41187923)
chr2 (140-240)||(33634448-33634549)
chr2 (182-249)||(36480438-36480502)
chr2 (193-249)||(1773644-1773700)
chr2 (195-251)||(44023347-44023403)
chr2 (187-241)||(20963118-20963172)
chr2 (218-252)||(29299353-29299387)
chr2 (199-252)||(44548721-44548774)
chr2 (126-200)||(2149243-2149319)
chr2 (152-240)||(31088343-31088431)
chr2 (163-251)||(31596430-31596518)
chr2 (167-250)||(34420227-34420310)
chr2 (162-249)||(43303292-43303379)
chr2 (198-252)||(13514048-13514102)
chr2 (167-249)||(29802834-29802916)
chr2 (124-201)||(40968963-40969041)
chr2 (212-250)||(44997756-44997794)
chr2 (182-251)||(5035327-5035396)
chr2 (198-251)||(10702174-10702227)
chr2 (163-250)||(30721861-30721941)
chr2 (189-241)||(35443873-35443925)
[»] chr3 (99 HSPs)
chr3 (124-252)||(47219124-47219253)
chr3 (124-252)||(47749103-47749231)
chr3 (124-252)||(29127899-29128028)
chr3 (124-252)||(29135893-29136022)
chr3 (124-251)||(7328824-7328951)
chr3 (124-250)||(54261206-54261333)
chr3 (126-252)||(3136692-3136818)
chr3 (124-252)||(15320166-15320295)
chr3 (137-252)||(28572209-28572325)
chr3 (124-250)||(35315936-35316063)
chr3 (124-250)||(45877434-45877561)
chr3 (124-250)||(47471812-47471938)
chr3 (124-252)||(25294940-25295069)
chr3 (127-246)||(10040540-10040659)
chr3 (124-251)||(15795493-15795620)
chr3 (124-249)||(6462392-6462518)
chr3 (124-252)||(13893906-13894035)
chr3 (124-252)||(33251642-33251771)
chr3 (124-251)||(49543499-49543627)
chr3 (127-249)||(3507534-3507657)
chr3 (124-252)||(42412775-42412901)
chr3 (124-241)||(49198331-49198449)
chr3 (124-249)||(51682955-51683081)
chr3 (124-249)||(53649707-53649833)
chr3 (144-252)||(26043812-26043921)
chr3 (124-252)||(41630510-41630639)
chr3 (124-252)||(51060279-51060408)
chr3 (124-247)||(26207804-26207928)
chr3 (126-228)||(3755552-3755655)
chr3 (124-250)||(29762155-29762282)
chr3 (124-250)||(30767247-30767374)
chr3 (126-251)||(55069678-55069804)
chr3 (124-252)||(7310701-7310830)
chr3 (140-251)||(7650223-7650335)
chr3 (124-251)||(48342000-48342128)
chr3 (162-252)||(26361965-26362055)
chr3 (182-252)||(49021201-49021271)
chr3 (138-248)||(8362571-8362682)
chr3 (141-251)||(23511564-23511675)
chr3 (126-252)||(54237430-54237557)
chr3 (152-245)||(50405608-50405702)
chr3 (124-221)||(39849052-39849149)
chr3 (183-252)||(44064584-44064653)
chr3 (134-245)||(40660332-40660444)
chr3 (137-252)||(45402349-45402465)
chr3 (162-252)||(8164572-8164662)
chr3 (126-251)||(31072860-31072986)
chr3 (194-252)||(36043672-36043730)
chr3 (182-252)||(43330730-43330800)
chr3 (124-237)||(52364813-52364927)
chr3 (124-252)||(928580-928709)
chr3 (133-250)||(22909773-22909890)
chr3 (147-252)||(24506646-24506751)
chr3 (139-251)||(30045816-30045929)
chr3 (125-245)||(33688932-33689053)
chr3 (163-251)||(7648760-7648848)
chr3 (130-250)||(45450447-45450567)
chr3 (152-248)||(4638162-4638259)
chr3 (165-250)||(19146983-19147068)
chr3 (124-228)||(32873571-32873675)
chr3 (162-250)||(13367443-13367531)
chr3 (124-252)||(35998569-35998697)
chr3 (124-217)||(28242258-28242352)
chr3 (182-252)||(34374440-34374510)
chr3 (124-245)||(35923628-35923750)
chr3 (124-233)||(40944863-40944972)
chr3 (138-252)||(19873361-19873481)
chr3 (117-249)||(34662320-34662453)
chr3 (127-251)||(41219576-41219700)
chr3 (124-232)||(47303507-47303616)
chr3 (185-249)||(2029268-2029332)
chr3 (175-251)||(2668093-2668169)
chr3 (126-222)||(3763033-3763129)
chr3 (127-225)||(49082807-49082906)
chr3 (189-251)||(47164152-47164214)
chr3 (182-251)||(10043721-10043790)
chr3 (124-250)||(38394175-38394300)
chr3 (199-240)||(8683250-8683291)
chr3 (202-251)||(21325123-21325172)
chr3 (187-252)||(29195317-29195382)
chr3 (186-251)||(50753340-50753405)
chr3 (124-215)||(11687144-11687236)
chr3 (166-252)||(15084943-15085029)
chr3 (125-245)||(22405548-22405669)
chr3 (140-249)||(25515749-25515858)
chr3 (152-245)||(41223043-41223136)
chr3 (127-222)||(7139735-7139831)
chr3 (143-218)||(10855383-10855459)
chr3 (152-251)||(52168569-52168669)
chr3 (166-213)||(34460547-34460594)
chr3 (124-190)||(37092565-37092632)
chr3 (124-189)||(7612987-7613053)
chr3 (126-180)||(10043132-10043186)
chr3 (199-249)||(11393476-11393526)
chr3 (126-251)||(26590265-26590391)
chr3 (182-240)||(32522018-32522076)
chr3 (124-185)||(11025438-11025499)
chr3 (185-238)||(24146340-24146393)
chr3 (186-250)||(37319889-37319953)
[»] chr1 (98 HSPs)
chr1 (127-251)||(9659178-9659302)
chr1 (124-251)||(11397888-11398015)
chr1 (127-252)||(41663854-41663980)
chr1 (127-252)||(49078098-49078224)
chr1 (124-251)||(5855503-5855631)
chr1 (126-252)||(26325795-26325922)
chr1 (124-252)||(37339800-37339930)
chr1 (124-252)||(8763972-8764101)
chr1 (124-252)||(18915848-18915977)
chr1 (124-252)||(43959819-43959948)
chr1 (124-251)||(10172970-10173098)
chr1 (124-251)||(10422769-10422897)
chr1 (124-251)||(16956447-16956575)
chr1 (124-251)||(45361881-45362009)
chr1 (124-250)||(33004015-33004142)
chr1 (130-251)||(26660125-26660246)
chr1 (126-251)||(50503360-50503486)
chr1 (124-252)||(17642002-17642131)
chr1 (126-250)||(16263528-16263653)
chr1 (124-240)||(14254278-14254395)
chr1 (124-252)||(34719757-34719886)
chr1 (124-251)||(2980930-2981058)
chr1 (124-251)||(30927726-30927854)
chr1 (124-251)||(40288476-40288604)
chr1 (124-216)||(47312933-47313025)
chr1 (152-250)||(21849205-21849303)
chr1 (124-240)||(33418125-33418242)
chr1 (175-251)||(4581681-4581757)
chr1 (124-251)||(32142845-32142972)
chr1 (124-250)||(45726433-45726560)
chr1 (131-252)||(34697323-34697445)
chr1 (143-251)||(33498838-33498947)
chr1 (143-252)||(44969665-44969774)
chr1 (124-251)||(15465946-15466074)
chr1 (124-251)||(32150921-32151049)
chr1 (126-252)||(892300-892422)
chr1 (124-250)||(18649352-18649479)
chr1 (124-241)||(10336497-10336615)
chr1 (163-252)||(50094925-50095014)
chr1 (124-251)||(32852-32980)
chr1 (182-250)||(5504071-5504139)
chr1 (124-215)||(48798105-48798197)
chr1 (166-250)||(50371834-50371918)
chr1 (124-250)||(2567257-2567384)
chr1 (165-240)||(10507721-10507796)
chr1 (185-252)||(35211170-35211237)
chr1 (130-252)||(17389759-17389881)
chr1 (124-250)||(26258677-26258803)
chr1 (182-251)||(6899598-6899667)
chr1 (124-252)||(9853275-9853404)
chr1 (127-223)||(13265922-13266019)
chr1 (130-243)||(25165388-25165501)
chr1 (124-228)||(5063866-5063970)
chr1 (124-251)||(15238105-15238233)
chr1 (127-250)||(31576547-31576671)
chr1 (129-247)||(17092480-17092599)
chr1 (182-252)||(35908798-35908866)
chr1 (126-251)||(17358470-17358596)
chr1 (197-251)||(51437512-51437566)
chr1 (163-251)||(12036742-12036831)
chr1 (124-252)||(12744521-12744650)
chr1 (124-252)||(12755511-12755640)
chr1 (124-192)||(34334353-34334422)
chr1 (141-252)||(18708538-18708650)
chr1 (193-252)||(3850740-3850799)
chr1 (167-250)||(14357780-14357863)
chr1 (167-250)||(19195391-19195469)
chr1 (124-251)||(46929737-46929864)
chr1 (152-245)||(38859121-38859215)
chr1 (127-215)||(28324615-28324704)
chr1 (165-238)||(48761199-48761272)
chr1 (124-251)||(13262064-13262192)
chr1 (124-251)||(18808246-18808374)
chr1 (124-211)||(34877971-34878059)
chr1 (195-251)||(47084175-47084231)
chr1 (126-252)||(28416929-28417056)
chr1 (165-251)||(42744801-42744881)
chr1 (194-252)||(1764195-1764253)
chr1 (127-216)||(17988694-17988783)
chr1 (127-252)||(25178574-25178699)
chr1 (124-252)||(31152697-31152825)
chr1 (189-250)||(45536769-45536830)
chr1 (124-204)||(2270301-2270379)
chr1 (164-252)||(5143152-5143239)
chr1 (202-250)||(34878626-34878674)
chr1 (167-226)||(38791634-38791693)
chr1 (213-251)||(40702585-40702623)
chr1 (175-241)||(42710147-42710213)
chr1 (197-250)||(8905163-8905216)
chr1 (124-200)||(45536689-45536766)
chr1 (124-172)||(41743254-41743302)
chr1 (124-214)||(6563422-6563513)
chr1 (124-190)||(8905211-8905277)
chr1 (124-198)||(31734270-31734344)
chr1 (124-252)||(41696596-41696724)
chr1 (166-234)||(44716231-44716299)
chr1 (170-250)||(50952261-50952341)
chr1 (126-173)||(51437452-51437500)
[»] scaffold0291 (1 HSPs)
scaffold0291 (137-251)||(6851-6966)
[»] scaffold0016 (1 HSPs)
scaffold0016 (130-251)||(8699-8821)
[»] scaffold0004 (2 HSPs)
scaffold0004 (123-252)||(7832-7962)
scaffold0004 (124-252)||(94977-95105)
[»] scaffold0002 (3 HSPs)
scaffold0002 (124-252)||(319405-319534)
scaffold0002 (124-251)||(553-681)
scaffold0002 (124-178)||(412097-412152)
[»] scaffold0010 (2 HSPs)
scaffold0010 (150-252)||(155708-155811)
scaffold0010 (124-249)||(25784-25910)
[»] scaffold0006 (1 HSPs)
scaffold0006 (124-252)||(68500-68626)
[»] scaffold0009 (2 HSPs)
scaffold0009 (139-250)||(42831-42943)
scaffold0009 (126-249)||(9421-9551)
[»] scaffold0376 (1 HSPs)
scaffold0376 (124-250)||(12653-12780)
[»] scaffold0316 (1 HSPs)
scaffold0316 (139-251)||(1612-1725)
[»] scaffold0170 (1 HSPs)
scaffold0170 (124-240)||(9828-9945)
[»] scaffold0209 (1 HSPs)
scaffold0209 (124-252)||(12558-12685)
[»] scaffold0384 (1 HSPs)
scaffold0384 (126-241)||(5958-6073)
[»] scaffold0079 (1 HSPs)
scaffold0079 (124-251)||(8158-8274)
[»] scaffold0029 (1 HSPs)
scaffold0029 (140-252)||(41043-41156)
[»] scaffold0005 (4 HSPs)
scaffold0005 (173-250)||(250024-250101)
scaffold0005 (124-220)||(271103-271200)
scaffold0005 (173-251)||(219402-219480)
scaffold0005 (127-252)||(249308-249428)
[»] scaffold0011 (2 HSPs)
scaffold0011 (127-250)||(224303-224427)
scaffold0011 (173-249)||(186550-186626)
[»] scaffold0001 (1 HSPs)
scaffold0001 (162-251)||(65150-65239)
[»] scaffold0086 (1 HSPs)
scaffold0086 (139-250)||(26181-26293)
[»] scaffold0050 (2 HSPs)
scaffold0050 (124-252)||(72616-72744)
scaffold0050 (187-251)||(72802-72866)
[»] scaffold0041 (1 HSPs)
scaffold0041 (161-250)||(25106-25195)
[»] scaffold0223 (1 HSPs)
scaffold0223 (167-250)||(16906-16989)
[»] scaffold0155 (1 HSPs)
scaffold0155 (163-249)||(19278-19364)
[»] scaffold0013 (1 HSPs)
scaffold0013 (145-250)||(51735-51837)
[»] scaffold0116 (1 HSPs)
scaffold0116 (130-241)||(17379-17491)
[»] scaffold0045 (1 HSPs)
scaffold0045 (167-250)||(58032-58115)
[»] scaffold0024 (1 HSPs)
scaffold0024 (163-251)||(149408-149496)
[»] scaffold0341 (1 HSPs)
scaffold0341 (124-214)||(18615-18706)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 72)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 38579101 - 38578866
Alignment:
16 atcttcacacggacagtcataatatgacggggtgtattaatgactagggcgtatttttccctttgtccttgctattagaatgaggttcatattatgaccg 115  Q
    |||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
38579101 atcttcacacgggcggtcataatatgaccgggtgtattaatgactagggcgtatttttccctttgtccttgctattagaatgaggttcatattatgattg 38579002  T
116 ggagctcgtccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagt 214  Q
    ||||||| |||||||||||| |||||||||| ||| ||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||    
38579001 ggagctcttccaaggacgtacccggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagt 38578902  T
215 cgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||||||||||||||||||    
38578901 cgcccacctttggtgggtcggaaaccggtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 48804666 - 48804794
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||||||||  |||||| ||||||||||||||||||||||||||||||||||| |||||    
48804666 tccaaggacgtatccggggaataccgggttcgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 48804765  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||||||||||||||||||||    
48804766 attggtgggtcggaaaccggtgcgaaagc 48804794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 13095843 - 13095970
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| |||||||||||||| ||| ||||||||||| ||||||  |||||| |||||||||||||||||||||||||||||||||||| ||||||    
13095843 caaggacgtacccggggaataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctt 13095942  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||| ||||||    
13095943 tggtgggtcggaaaccggtgcaaaagcc 13095970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 10048002 - 10047873
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||||| ||||||  |||||| ||||||| |||||||||||||||| | |||||||| |||||    
10048002 tccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccacc 10047903  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||||||||||||||    
10047902 attggtgggtcggaaaccggtgcgaaagcc 10047873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 17748508 - 17748379
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||| ||||||||||||||| ||||||| |||||| ||||||||||||||||| | ||||||||||||||| |||||    
17748508 tccaaggacgtattcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacc 17748409  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |||||||||||||| ||||||||||    
17748408 tttgttgggtcggaaaccgatgcgaaagcc 17748379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 43862098 - 43861969
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||||| |||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||   ||||    
43862098 tccaaagacgtatctggggaataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacc 43861999  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||| |||||||||||||||||    
43861998 tttggtggatcgaaaaccggtgcgaaagcc 43861969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 42210388 - 42210259
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| |||||||||| |||||||||||| | || |||||||||||| ||||||||||||||||||| ||||||||||| || ||||||    
42210388 tccaaggacgtatccgaggaataccggcttcgattcccagtgaaaacaacgtttggccagtgcgcatgcctctacgcacgagccggattaatcacccacc 42210289  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||| ||||||||||    
42210288 gttggtgggtcggaaaccgatgcgaaagcc 42210259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 1605924 - 1606053
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||| ||||||| | ||||||| ||||||| ||||||| |||||| |||| |||||||||| || ||||||||||||||||||||||    
1605924 tccaaggacgtacccggagaatacctggttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacc 1606023  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||||||||||||||||||    
1606024 tttggtggatcggaaaccggtgcgaaagcc 1606053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 22993493 - 22993364
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||| ||| ||||||||| ||| ||||||||| |||||| ||| ||||||||||||||| || ||||||||||||| ||||    
22993493 tccaaggacgtacccggggaatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacc 22993394  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
22993393 tttggtgggtcagaaaccggtgcgaaagcc 22993364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 125 - 251
Target Start/End: Complemental strand, 4195327 - 4195200
Alignment:
125 ccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||||||||||||||  ||||||| ||||| |||||||| ||||||  |||||||||||||||||||||||||||||||| || |||||     
4195327 ccaaggacgtatccggggaataccgagttcgatttccaggaggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccacca 4195228  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| |||||||| |||||||||    
4195227 ttggtgggttggaaaccgatgcgaaagc 4195200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 248
Target Start/End: Original strand, 18785652 - 18785777
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||| ||||| ||||||  |||||| |||||||||||||||||||||| | ||||||||||  ||||    
18785652 tccaaggacgtacccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacc 18785751  T
223 tttggtgggtcggaaaccggtgcgaa 248  Q
    | ||||||||||||||||||||||||    
18785752 tctggtgggtcggaaaccggtgcgaa 18785777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 22973950 - 22974079
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  ||||||||||||| |||||||| |||||| ||||||| |||||| ||| |||||| |||||||||||||| ||||||||| |||||    
22973950 tccaaggacgtactcggggaataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacc 22974049  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| |||||||| |||||||||    
22974050 tttggtgggtcagaaaccggcgcgaaagcc 22974079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 34659209 - 34659337
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||| ||| ||| |||||||||||||| |||||||| || ||||||||||| ||| || ||||||||||||||||||| |||||||||||||||||||||    
34659209 tccagggatgtacccggggaataccgggttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccacc 34659308  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     |||||| |||| ||||||||||||||||    
34659309 attggtgtgtcgaaaaccggtgcgaaagc 34659337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 5069938 - 5069812
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||| ||||| |||||||| ||||||| ||||| ||||||||| || ||  ||| |||||||||||||||  |||||||||||||||||||||||    
5069938 aaggacgtacccgggaaataccgggttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccaccttt 5069839  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||| ||||||||||    
5069838 ggtgggtcggaaaccgatgcgaaagcc 5069812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 1797443 - 1797572
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| |||||||||| ||||||||||||||| ||||||| |||||| ||||||||| ||||||||| |||||||| |||||| ||| |    
1797443 tccaaggacgtatccgaggaataccgggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatc 1797542  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||| ||| |||||||||| ||||||    
1797543 tttgatggatcgaaaaccggtgcaaaagcc 1797572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 16802106 - 16802235
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||  ||| ||||||||| |||||| ||||| ||||||||||||| |||||||||||||||| ||||    
16802106 tccaaggacgtacccggggaataccggattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgcacgagccggattagtcgctcacc 16802205  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||||| |||| ||||| ||||||    
16802206 attggtgggtcgaaaactggtgcaaaagcc 16802235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 47341859 - 47341988
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||  ||||||||||||||| ||||||  |||||| ||||||||||||||||||| |||| ||||| ||||  ||||    
47341859 tccaaggacgtacccggggaataccgagttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcacc 47341958  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||||||||| |||||||||||||    
47341959 attggtgggtcggaaatcggtgcgaaagcc 47341988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 42032079 - 42032207
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||| | ||||||||||| |||||||||||||||||| |||| ||| | ||||||||||||||| |||||| | |||||    
42032079 tccaaggacgtacccggggaatacctggttcgattcccacggggaacaacgtttggccagtgcacatacatctacgcatgagccgaattagttgtccacc 42032178  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||||||||| ||| |||||    
42032179 tttgatgggtcggaaaccgatgctaaagc 42032207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 43346905 - 43346777
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||||| |||||||||||| ||| |||| || ||||||||||  |||||| ||||||||||||||||| | |||||||||||||||| || |    
43346905 tccaaagacgtatctggggaataccgggttcaattctcaaggggaacaacacttggccggtgcgcatgcctctacgtacgagccggattagtcgctcatc 43346806  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||| ||||||||||    
43346805 tttggtgggtcggaaaccagtgcgaaagc 43346777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 3353411 - 3353534
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||||||||  ||||||| |||  ||||||| ||||| |||||| ||||||| ||||||||||||||||||| ||||||||||||||| |||||||||    
3353411 aaggacgtatctagggaatatcgggatcgattctcagggaaacaacatttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttg 3353510  T
227 gtgggtcggaaaccggtgcgaaag 250  Q
     ||| || ||||||||||||||||    
3353511 atggatcagaaaccggtgcgaaag 3353534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 27028262 - 27028389
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| | ||| |||||| | ||||||| ||||||| ||||||  |||||| |||||||||||||||| ||||||| ||||||||||| ||||    
27028262 tccaagaacgtacctgggaaataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacc 27028361  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||||||||||    
27028362 tttggtgggtcggaaaccggtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 244
Target Start/End: Complemental strand, 4228877 - 4228759
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||||| |||||||| | ||||||| |||||  |||||||||||||| |||| |||||| |||||||||||||||||||||||||||||     
4228877 tccaaggacgtatccgaggaataccaggttcgatttccagg--aacaacgtttggccagtgcacatgcccctacgcatgagccggattagtcgcccacca 4228780  T
224 ttggtgggtcggaaaccggtg 244  Q
    ||| ||||||| ||| |||||    
4228779 ttgatgggtcgaaaatcggtg 4228759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 39474922 - 39475051
Alignment:
124 tccaaggacgtatccgggga-ataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    ||||| |||||||||||||  ||||||| ||||||||| | ||||||||||| |||| | |||||||| |||||||||||||||||||||||||| ||||    
39474922 tccaaagacgtatccgggggtataccgggttcgattcctatggggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccac 39475021  T
222 ctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||| ||||| ||||||||||    
39475022 ctttagtgggtcgaaaaccagtgcgaaagc 39475051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 21190906 - 21190778
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| ||||||||||||||||| ||||||||| ||| ||| ||||| |||||  ||||||||||||||||||| ||| | ||||||||||||| |    
21190906 tccaaggacttatccggggaataccgggttcgattcctaggaggagcaacgcttggctagtgcgcatgcctctacgcacgagtcagattagtcgcccatc 21190807  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
      |||||||||| ||||||||||||||||    
21190806 aatggtgggtcgaaaaccggtgcgaaagc 21190778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 130 - 249
Target Start/End: Complemental strand, 27875208 - 27875088
Alignment:
130 gacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||||| |||||||||||| ||||||||||||||| || |||  |||||| |||| |||||||||||||||||| || |||||||| |||||||| ||    
27875208 gacgtatctggggaataccggattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagt 27875109  T
229 gggtcggaaaccggtgcgaaa 249  Q
    |||||| ||||||||||||||    
27875108 gggtcgaaaaccggtgcgaaa 27875088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 39420823 - 39420949
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||| ||| |||||||||||||||| ||| |||||  |||||||||| |||||| |||||| |||||||||||||||||||||||||||| | |||||    
39420823 caaggaggtacccggggaataccggtt-cgaatcccaaagggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcgtctacctt 39420921  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    || |||| ||||||||||||| ||||||    
39420922 tgatgggccggaaaccggtgcaaaagcc 39420949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 26423413 - 26423288
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||  |||||||||| ||||||||||||||||| ||||| |||||| |||| | |||||||||||| ||||| |||||||||  ||||    
26423413 tccaaggacgtacccaaggaataccgggttcgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacc 26423314  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||| ||||||||||||||||||||    
26423313 tttggt-ggtcggaaaccggtgcgaaa 26423288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 36619378 - 36619252
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||  |||||||||||| ||||||||||||||| ||||||  ||| || ||| ||||||||||||||||||||||||||||||| ||||| |    
36619378 caaggacgtatttggggaataccgggttcgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccat 36619279  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||  ||||| ||| ||||||    
36619278 tggtgggtcaaaaaccagtgtgaaagc 36619252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 14650300 - 14650429
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||| ||||| ||| ||||||| ||||| ||||||| | ||| || ||||  ||||||||||||||||||||| |||||||| ||||    
14650300 tccaaggacgtacccggagaatatcgggttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacc 14650399  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| | |||||||||||||||||    
14650400 tttggtgggttgaaaaccggtgcgaaagcc 14650429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 21530731 - 21530860
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||||||||| || || |||||||||||| ||||||  |||| | |||| |||||||||||||| |||||| |||| |||| ||||    
21530731 tccaaggacgtacctggggaatactgggtttgattcccagggggaacaacacttggtcagtgcacatgcctctacgcacgagccgaattaatcgctcacc 21530830  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||| ||||||||    
21530831 tttggtgggtcggaaaccggttcgaaagcc 21530860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 8734772 - 8734684
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| | |||| | ||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
8734772 ggggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 8734684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 126 - 243
Target Start/End: Complemental strand, 28396284 - 28396166
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||| ||||||||||| |||| ||| ||| |||| |||||| ||||||| || ||  |||||||||||| |||||||||||||||||||||| | |||||    
28396284 caagaacgtatccgggaaatatcgggttcaattctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctt 28396185  T
225 tggtgggtcggaaaccggt 243  Q
    |||||||||||||||||||    
28396184 tggtgggtcggaaaccggt 28396166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 164 - 250
Target Start/End: Original strand, 41945497 - 41945583
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||| |||| |||||| ||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||| |||||||||||    
41945497 gggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag 41945583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 124 - 245
Target Start/End: Complemental strand, 45960128 - 45960007
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||||||  || |||||||| ||| ||||||  |||| | |||||||||||||||||||| ||||||||||||||| ||||    
45960128 tccaaggacgtatc-ggggaataccgagtttgattcccaagggcaacaacacttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacc 45960030  T
223 tttggtgggtcggaaaccggtgc 245  Q
    |||| ||| ||||||||||||||    
45960029 tttgatggatcggaaaccggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 166 - 252
Target Start/End: Original strand, 48551883 - 48551969
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||||||  |||||||||||||||| ||||||||||||||||| ||||||||| ||| |||||||||||||||||||||    
48551883 gaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagcc 48551969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 139 - 252
Target Start/End: Complemental strand, 49142780 - 49142666
Alignment:
139 ggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    |||||||||||| ||||||||| ||||| ||||||| || ||| |||| |||||||||||||| ||||||||||||| ||||||||||| ||||||| ||    
49142780 ggggaataccgggttcgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaa 49142681  T
238 accggtgcgaaagcc 252  Q
    |  ||||||||||||    
49142680 attggtgcgaaagcc 49142666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 45697305 - 45697188
Alignment:
134 tatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtc 233  Q
    ||||||||||||| | | |||||||| ||||||||||||  |||  | |||||||||||||||||||||||  || ||||||| ||||||||||||||||    
45697305 tatccggggaatatcagattcgattctcaggggaacaacacttgatcagtgcgcatgcctctacgcatgagttgggttagtcgtccacctttggtgggtc 45697206  T
234 ggaaaccggtgcgaaagc 251  Q
    ||||||| || |||||||    
45697205 ggaaaccagtacgaaagc 45697188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 43925495 - 43925623
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||| ||||||||||  |||| | |||||||||||||||||||||||| |||||||| |   |||    
43925495 tccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacc 43925594  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| || ||||||| || ||||||    
43925595 tttgatggatcagaaaccgatgtgaaagc 43925623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 37514904 - 37515031
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| || ||||||||||| || |||||||  ||| ||||||||||||||| | ||||||||| ||||||||| ||||||||||| |||  ||||    
37514904 tccaaggacatacccggggaatactgggttcgattttcagtgggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcacc 37515003  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     || |||||||||||||||||| |||||    
37515004 attagtgggtcggaaaccggtgtgaaag 37515031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 48244480 - 48244353
Alignment:
126 caaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||  |||||||||||| ||| ||| | | ||||||||| | |||  | |||||  ||||||||||||||||||||||||||||| ||||||    
48244480 caaggacgtatttggggaataccgggttcaatttctaaggggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctt 48244381  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| ||| |||||||||||||||||    
48244380 tggtggatcgaaaaccggtgcgaaagcc 48244353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 133 - 245
Target Start/End: Complemental strand, 5039535 - 5039422
Alignment:
133 gtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtggg 231  Q
    |||| ||||||||||||  ||||||||| ||| ||||||||  |||| | |||| ||| ||||||||||||||||||||||||||| ||||||||||||     
5039535 gtattcggggaataccgagttcgattcctaggaggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtgga 5039436  T
232 tcggaaaccggtgc 245  Q
    ||| ||||||||||    
5039435 tcgaaaaccggtgc 5039422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 131 - 251
Target Start/End: Complemental strand, 10317864 - 10317744
Alignment:
131 acgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    ||||| |||||||||||||| ||||||||||||||| || |||  |||| | ||||| ||||||||| |||| ||| | ||||||||| |||||||||||    
10317864 acgtacccggggaataccgggttcgattcccagggggaataacacttggtcagtgcgtatgcctctatgcataagcag-attagtcgctcacctttggtg 10317766  T
230 ggtcggaaaccggtgcgaaagc 251  Q
    | ||||||||||||||||||||    
10317765 gatcggaaaccggtgcgaaagc 10317744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 124 - 241
Target Start/End: Complemental strand, 19914828 - 19914711
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |   ||||||| || |||||||||||  ||||||||| ||||||  |||||||||||||||||||||||| ||||| ||||||||||    
19914828 tccaaggacgtacctaaggaatactgggttcgattcccaaaggaacaacgcttggccaatgcgcatgcctctacgcatgagccagattaatcgcccacct 19914729  T
224 ttggtgggtcggaaaccg 241  Q
    ||| ||||| | ||||||    
19914728 ttgatgggttgtaaaccg 19914711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 116 - 252
Target Start/End: Original strand, 23658154 - 23658291
Alignment:
116 ggagctcgtccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagt 214  Q
    ||||||| | |||||||||| || ||||||| |   ||||||| ||||||| ||||||| |||||| ||| |||||||||||| || |||||||||||||    
23658154 ggagctccttcaaggacgtacccagggaatatccagttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagt 23658253  T
215 cgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || ||| |||||||||||| |||||| |||| ||||||    
23658254 cgtccatctttggtgggtcagaaacctgtgcaaaagcc 23658291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 131 - 250
Target Start/End: Original strand, 365130 - 365250
Alignment:
131 acgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    ||||||||| |||||||||| |||||||| |||| ||||||||| ||   | ||||||||||||||||||||||||| |||||||  ||||||  |||||    
365130 acgtatccgaggaataccgggttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctctacgcatgagcctgattagtgacccaccagtggtg 365229  T
230 ggtcggaaaccggtgcgaaag 250  Q
    ||||| |||||| ||||||||    
365230 ggtcgaaaaccgatgcgaaag 365250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 141 - 252
Target Start/End: Original strand, 29151940 - 29152052
Alignment:
141 ggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||||||||| |||||||||||||  |||||||||||| || |||||||||||||||| || || |||||||| ||| | ||| ||| ||||||||||||    
29151940 ggaataccgggttcgattcccaggaagaacaacgtttgaccagtgcgcatgcctctacacacgatccggattaatcgtctaccattgatgggtcggaaac 29152039  T
240 cggtgcgaaagcc 252  Q
    || ||||||||||    
29152040 cgatgcgaaagcc 29152052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 126 - 250
Target Start/End: Complemental strand, 29805563 - 29805439
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||| ||| ||||||||  ||||||||  | ||||||||||||||| | ||||||||| |||||||||||||||  |||| ||| | ||||||    
29805563 caaggacgtattcggagaataccgagttcgattcatatgggaacaacgtttggtcagtgcgcatgtctctacgcatgagccaaattaatcgtctaccttt 29805464  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
     ||| |||||||||| |||||||||    
29805463 agtgagtcggaaaccagtgcgaaag 29805439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 139 - 250
Target Start/End: Original strand, 22573811 - 22573922
Alignment:
139 ggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||| ||| |||||||  |||||||||||| |||| || |||||||||||| |||||||||||||||||| ||| ||| | ||| ||||| | |||    
22573811 ggggaatatcgggttcgattttcaggggaacaacatttgaccagtgcgcatgcctttacgcatgagccggattaatcgtccatcattgatgggttgaaaa 22573910  T
239 ccggtgcgaaag 250  Q
    ||||||||||||    
22573911 ccggtgcgaaag 22573922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 24983486 - 24983415
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtc-ggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||| ||||||||||    
24983486 gtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaagcc 24983415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 137 - 250
Target Start/End: Original strand, 3603349 - 3603467
Alignment:
137 ccggggaataccggtttcgattc-ccaggggaacaacgtttggc----ccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtggg 231  Q
    |||||||||||||| ||||||||    |||||||||||||||||    | ||||||||||||||||||| ||||||||||| |||  ||| |||||||||    
3603349 ccggggaataccgggttcgattctttgggggaacaacgtttggccggtcagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtggg 3603448  T
232 tcggaaaccggtgcgaaag 250  Q
    ||||||| |||||||||||    
3603449 tcggaaatcggtgcgaaag 3603467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 28744185 - 28744274
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| | |||||| || ||||| |||||||  | ||||||||||||||| |||||||||||||||||||||| ||||||||||||    
28744185 ggggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagcc 28744274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 32823254 - 32823355
Alignment:
152 ttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| ||||||  |||||| ||| | ||||||||||||| ||||||||||||||||  ||| ||| |||||||||||| ||||||||||    
32823254 ttcgattcccagggggaacaacacttggccggtgtgtatgcctctacgcacgagccggattagtcgcagaccattgatgggtcggaaacgggtgcgaaag 32823353  T
251 cc 252  Q
    ||    
32823354 cc 32823355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 24969448 - 24969324
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||| ||  |||||||| ||||||| |||||| ||||||  |||||| |||||| |||||||||| |  || ||||||| |||| || ||||    
24969448 caaggacgtatctggaaaataccgggttcgatttccaggg-aacaacacttggccagtgcgcgtgcctctacgtacaagtcggattaatcgctcatcttt 24969350  T
226 ggtgggtcggaaaccggtgcgaaagc 251  Q
    | ||| ||||||||||||||||||||    
24969349 gatggctcggaaaccggtgcgaaagc 24969324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 247
Target Start/End: Original strand, 14535274 - 14535398
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  | ||||||||||| ||  |||  ||||| |||||||  |||||| ||| ||||||||||||||| |||| ||||||||||||||||    
14535274 tccaaggacgtactccgggaataccgggtttcattttcagggagaacaacacttggccagtgtgcatgcctctacgcacgagctggattagtcgcccacc 14535373  T
223 tttggtgggtcggaaaccggtgcga 247  Q
     ||| |||||| ||||| |||||||    
14535374 attgatgggtcagaaactggtgcga 14535398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 34127698 - 34127643
Alignment:
196 acgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||||||||||||||||||||||||||||||||  ||||||||||||||||    
34127698 acgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtgcgaaagc 34127643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 242
Target Start/End: Original strand, 45447953 - 45448072
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| | |||||| | ||||||| |||||| |||||||| |||||  |||||||| ||||||| ||  || | |||||||| ||||||    
45447953 tccaaggacgtacccgagaaataccaggttcgatttccagggagaacaacgcttggctagtgcgcatccctctacacactagtcagattagtcacccacc 45448052  T
223 tttggtgggtcggaaaccgg 242  Q
    ||| ||||||||||||||||    
45448053 tttagtgggtcggaaaccgg 45448072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 267 - 313
Target Start/End: Complemental strand, 38578842 - 38578796
Alignment:
267 gaatgaggttcgtattaatgaggaaagaagggtttgtatgaatgcat 313  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||    
38578842 gaatgaggttcatattaatgaggaaagaagggtttgtatgaatgcat 38578796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 32768984 - 32769049
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||| ||| |||||||||||  |||||||||||| ||||||||||||| |||||||    
32768984 catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagcc 32769049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 247
Target Start/End: Original strand, 38988942 - 38989006
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcga 247  Q
    |||| ||||||||||||||||| ||||||||||||| || |||||||||||| |||||||||||||    
38988942 gtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtgggtc-gaaaccggtgcga 38989006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 139 - 245
Target Start/End: Original strand, 9813974 - 9814077
Alignment:
139 ggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||| || |||||||||||| |||||||||| ||||| ||| ||||||  ||| ||| |||| |||||||||||||| ||||| ||  |||||||    
9813974 ggggaatactgggttcgattcccagtggaacaacgtatggccagtgtgcatgc--ctatgcacgagctggattagtcgccca-ctttgatgaatcggaaa 9814070  T
239 ccggtgc 245  Q
    |||||||    
9814071 ccggtgc 9814077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 22268155 - 22268039
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||   |||||||||||| ||||||||||||||| |||||| ||||||| ||||||||| |||             |||||||||| ||||    
22268155 tccaaggacgtacttggggaataccgggttcgattcccagggggaacaacatttggccagtgcgcatgactca------------gattagtcgctcacc 22268068  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| ||||||||||||||||||||    
22268067 tttggtggatcggaaaccggtgcgaaagc 22268039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 229
Target Start/End: Complemental strand, 4973236 - 4973130
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| ||| ||||||||| ||| ||||||||| | |||||| |||  ||| ||  |||||||||||||||| | ||||||||||||||| ||| |    
4973236 tccaaggacttattcggggaatatcgggttcgattcctacggggaataacacttgaccaatgcgcatgcctctacgtacgagccggattagtcgtccagc 4973137  T
223 tttggtg 229  Q
    |||||||    
4973136 tttggtg 4973130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 45758322 - 45758397
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| |||||||||||||||| |  |||  |||||| |||| |||||||||||||||||||||| |||||||||||    
45758322 ttggccagtgcgcatgcctctacac--gagttggattaatcgcacacctttggtgggtcggaaacccgtgcgaaagcc 45758397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 4706070 - 4705983
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| |||  | ||||||| |||||||| |||| |||||||||| ||||||||||| | ||| |||||| || |||||    
4706070 ggggaacaacgtttagccattacgcatgcttctacgcacgagctggattagtcgtccacctttggtagatcgaaaaccgatgtgaaag 4705983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 226
Target Start/End: Original strand, 30827291 - 30827378
Alignment:
140 gggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||| | |||||||  ||||| |||||||  |||||| || |||||||||||||||| ||||||||||||||| | |||||||    
30827291 gggaataccaggttcgattttcagggagaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcgtctacctttg 30827378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 241
Target Start/End: Complemental strand, 41267987 - 41267932
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||||||||||||||||   ||||||||| ||||||||| ||||||||||||||    
41267987 gcatgcctctacgcatgagttagattagtcgtccacctttgatgggtcggaaaccg 41267932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 250
Target Start/End: Original strand, 23060702 - 23060787
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| ||  || ||||||||  ||||||||| |||||||||||  |||||||||||| |   |||||||||||||||    
23060702 ggggaacaacgtttgaccaatgtgcatgcct--acgcatgagtcggattagtcgttcacctttggtggataaaaaaccggtgcgaaag 23060787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 48224856 - 48224729
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||||| ||||||| ||  ||| ||| ||| |||||||||| |||  | |||||||||  |||||| ||||| |  |||||||   || ||    
48224856 tccaaggacgtatccagggaatatcgagttcaatttccatgggaacaacgcttgatcagtgcgcatgtatctacgtatgagtcaaattagtccttcatct 48224757  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| |||||  |||||||||    
48224756 ttggtgggtcgaaaaccaatgcgaaagc 48224729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 245
Target Start/End: Original strand, 9685778 - 9685832
Alignment:
191 cctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    |||||||||||||||||||||||||  ||||| ||| ||| | ||||||||||||    
9685778 cctctacgcatgagccggattagtcatccaccattgatggataggaaaccggtgc 9685832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 173
Target Start/End: Complemental strand, 34127746 - 34127696
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacg 173  Q
    |||||||||||| |||||||||||||| ||||||||| ||| |||||||||    
34127746 tccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacg 34127696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 252
Target Start/End: Original strand, 39230545 - 39230611
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||| | ||||  ||||||| ||| |||||||| | ||||||    
39230545 gcatgcctctatgcatgagccggattagttgtccactattggtggatcgaaaaccggtacaaaagcc 39230611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 11607114 - 11607162
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaac 172  Q
    ||||||||||||| ||||||||| ||| |||||||| | ||||||||||    
11607114 tccaaggacgtattcggggaatatcggattcgattctctggggaacaac 11607162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 98; Significance: 3e-48; HSPs: 52)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 21898632 - 21898761
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||  ||||    
21898632 tccaaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacc 21898731  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||||||||||||||||||||||    
21898732 tttagtgggtcggaaaccggtgcgaaagcc 21898761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 5253349 - 5253221
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||| |||||||||    
5253349 tccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacc 5253250  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
5253249 tttggtgggtcggaaaccggtgcgaaagc 5253221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 29333264 - 29333138
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| || ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| ||||||    
29333264 tccaaggacgtacccagggaataccgggttcgatttccaggggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcgtccacct 29333165  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||| |||||| ||||||||||||||    
29333164 ttggtaggtcggtaaccggtgcgaaag 29333138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 6606223 - 6606094
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| |||||||| |||||| ||||||  |||||| |||  |||||||||||||||||||||||||||||| |||||    
6606223 tccaaggacgtatccggggaataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccacc 6606124  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||||||||||||||    
6606123 attggtgggtcggaaaccggtgcgaaagcc 6606094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 12606414 - 12606543
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| |||||||||||||||||| | ||||||| ||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||    
12606414 tccaagaacgtatccggggaataccagattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacc 12606513  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| |  |||||||||||||||||||    
12606514 tttggtgagctggaaaccggtgcgaaagcc 12606543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 30788977 - 30788850
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||| |||||||||||||| ||| || ||||| || || |||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||    
30788977 tccaaggatgtatccggggaatatcgggtttgattctcatgg-aacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacct 30788879  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||||||||    
30788878 ttggtgggtcggaaaccggtgcgaaagcc 30788850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 131 - 251
Target Start/End: Original strand, 3601075 - 3601196
Alignment:
131 acgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    |||||| |||||||||||||||||||||| |||||| ||||||| |||||| |||||||||||| ||| || ||||||||||||||| ||||||||||||    
3601075 acgtattcggggaataccggtttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtg 3601174  T
230 ggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||||||    
3601175 ggtcggaaaccggtgcgaaagc 3601196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 8612100 - 8611971
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||| ||| ||||||||| ||| || ||| |||||| ||||||||||| ||||||||||||||||||    
8612100 tccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacc 8612001  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
8612000 tttggtgggtcagaaaccggtgcgaaagcc 8611971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 8932645 - 8932774
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| |||||||||||||| ||| ||||||||||||||| ||||||  |||||  ||||||||||||||||||||||||||||||| || ||||||    
8932645 tccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacc 8932744  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |||||||||||||||||||||||||    
8932745 tttgatgggtcggaaaccggtgcgaaagcc 8932774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 8944111 - 8944240
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| |||||||||||||| ||| ||||||||||||||| ||||||  |||||  ||||||||||||||||||||||||||||||| || ||||||    
8944111 tccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacc 8944210  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |||||||||||||||||||||||||    
8944211 tttgatgggtcggaaaccggtgcgaaagcc 8944240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 12635798 - 12635927
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||| | || |||||||||||||| ||||| |||||  |||||||||||||||||||  |||||||||||||||||||     
12635798 tccaaggacgtatccggggaataccaggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccact 12635897  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||||||||||||||    
12635898 attggtgggtcggaaaccggtgcgaaagcc 12635927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 14107484 - 14107355
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||| ||||||||||||| ||||||||||||| ||||||||| ||| || |||| ||||||||||||||||||||||||||||||||||      
14107484 tccaaagacgtattcggggaataccgggttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccatt 14107385  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     || ||||||||||||||||||||||||||    
14107384 attagtgggtcggaaaccggtgcgaaagcc 14107355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 19089484 - 19089611
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||||| |||||||| | || |||||||||||| ||||||  |||||| ||| ||||||||||||||| ||||||||||||||| | |||||    
19089484 caaggacgtatccgaggaataccaggtttgattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctt 19089583  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||    
19089584 tggtgggtcggaaaccggtgcgaaagcc 19089611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 166 - 252
Target Start/End: Complemental strand, 9633708 - 9633622
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 9633622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 13468917 - 13469046
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||| | ||| ||||| ||||| ||||||| |||| | |||| |||||||||||||| ||||| |||||||||||||||    
13468917 tccaaggacgtatccggggaataccaggttcaattcctagggggaacaacgattggtcagtgcacatgcctctacgcacgagccagattagtcgcccacc 13469016  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||| |||||||||||||||||||    
13469017 attggtgggttggaaaccggtgcgaaagcc 13469046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 13036130 - 13036002
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||| ||| |||||||  |||||| ||||||  |||||| ||||||||||||||||||||||||| ||||||||| ||||     
13036130 tccaaggacgtattcggggaatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccact 13036031  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||||||||||||||||||||    
13036030 attggtgggtcggaaaccggtgcgaaagc 13036002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 29444891 - 29444762
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||| |||||| ||||||| ||||||| | ||||| ||||||| |||||| ||||||||||||||||||||||||||||||||| | ||| |    
29444891 tccaaagacgtacccgggggataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatc 29444792  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||  |||||||||||    
29444791 tttggtgggtcggaaactagtgcgaaagcc 29444762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 34954745 - 34954617
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||||| | |||||||| |||||| |||||||||||||| |||| ||| |||||||||||||||| ||||||||| |||||    
34954745 tccaaggacgtacctggggaataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacc 34954646  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||||||||  |||||||||    
34954645 tttgatgggtcggaaaccaatgcgaaagc 34954617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 3588071 - 3587942
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||||||| ||||||||| ||||||||||| ||||||||||| |||||| |||| ||| ||||||||||||| |||||||||||| | |||    
3588071 tccaaagacgtatccggagaataccgggttcgattcccaaggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcgtcaacc 3587972  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||| |||||||| | ||||||||||    
3587971 tttgatggatcggaaactgatgcgaaagcc 3587942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 8938695 - 8938822
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||| ||||||||||||||  | ||||||||||||| ||||||||  ||| || ||||||| || ||||||||||||||| |||||||| |||||    
8938695 tccaaagacatatccggggaatacttggttcgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacc 8938794  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| |||||||||||||||||||||||    
8938795 tttgatgggtcggaaaccggtgcgaaag 8938822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 245
Target Start/End: Complemental strand, 2271427 - 2271307
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||| ||||||||||||| |||||||| ||| | ||||||| || ||| ||||||||| ||||||||| ||||||||||||||| ||||||    
2271427 tccaaggacgtattcggggaataccgggttcgattctcagag-aacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacct 2271329  T
224 ttggtgggtcggaaaccggtgc 245  Q
    ||| |||||| |||||| ||||    
2271328 ttgatgggtcagaaaccagtgc 2271307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 5029829 - 5029930
Alignment:
152 ttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||| ||||||||||||| | |||||||||||||||||||||||  |||||||||||||| ||||| |||||||||||| ||||||||||    
5029829 ttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcgaaag 5029928  T
251 cc 252  Q
    ||    
5029929 cc 5029930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 10311595 - 10311467
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| |||||||||||||||||||| |||||| | || ||||||||||| |||||| ||||||||| ||||||||| |||   |||||||||| ||||    
10311595 tccaagaacgtatccggggaataccgggttcgatcctcaaggggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcacc 10311496  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||| |||| |||||||||||    
10311495 attggtgggtcgaaaactggtgcgaaagc 10311467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 9179862 - 9179735
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| || ||||||||||| ||||||||||||||| ||||||  ||| || ||  |||| ||||||||||||||| |||||||||| |||||    
9179862 tccaaggacgtacccagggaataccgggttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacc 9179763  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||||| |||| ||||||    
9179762 tttggtggatcggaaatcggtccgaaag 9179735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 11142587 - 11142713
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| || ||||| |||||||  |||||||| ||| |||| ||||||||| || ||||||||||||||||||||||| | ||||||| | ||| |    
11142587 tccaaggacatacccgggaaataccgagttcgattcgcagtggaaacaacgtttgaccagtgcgcatgcctctacgcatgagtcagattagttgtccaac 11142686  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||| ||||||||||||    
11142687 tttggtgggtcggagaccggtgcgaaa 11142713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 186 - 252
Target Start/End: Complemental strand, 14783483 - 14783417
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||    
14783483 gcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 14783417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 142 - 250
Target Start/End: Original strand, 13391289 - 13391397
Alignment:
142 gaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||| ||| |||||||  ||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||  |||  ||||||| ||||||    
13391289 gaatatcggattcgattttcaggggaacaatgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccatatttaatgggtcgaaaaccg 13391388  T
242 gtgcgaaag 250  Q
    |||| ||||    
13391389 gtgcaaaag 13391397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 13584576 - 13584443
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatg----agccggattagtcgcc 218  Q
    ||||||||||||  || |||||||| | ||||||||| | |  ||||||||||||||| ||||||||||||||| |||||    |||||||||| ||| |    
13584576 tccaaggacgtactcgaggaataccaggttcgattcctaagatgaacaacgtttggccagtgcgcatgcctctatgcatgcatgagccggattaatcgtc 13584477  T
219 cacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||| |||||||||    
13584476 cacctttggtgggtcggaaaccggcgcgaaagcc 13584443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 140 - 249
Target Start/End: Complemental strand, 8149906 - 8149797
Alignment:
140 gggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    ||||||| ||| ||||||||| ||| ||||||  |||| ||  ||| ||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||    
8149906 gggaatatcgggttcgattcctaggagaacaatatttgaccaatgcacatgcctctacgcattagccgaattagtcgtccacctttggtgggttggaaac 8149807  T
240 cggtgcgaaa 249  Q
    ||||||||||    
8149806 cggtgcgaaa 8149797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 31129201 - 31129289
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||||| |||||  ||||||||||||||||||||||||| ||||||| |  ||||||||||| |||||||||||||||||||||    
31129201 ggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc 31129289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 14326045 - 14326110
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||| ||||||    
14326045 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagcc 14326110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 14419055 - 14419120
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||| ||||||    
14419055 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagcc 14419120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 30410488 - 30410557
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||| |||||| |||| || |||||||||||||||||||| |||||||||    
30410488 gtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaagc 30410557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 17114981 - 17114901
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    ||||||||| ||||||  ||  |||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||    
17114981 ggaacaacgcttggccaatggacatgcctctacgcatgagccggattagtcgcccacctttgataggtcggaaatcggtgc 17114901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 240
Target Start/End: Original strand, 8888905 - 8888983
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||| |||||||||||||| |||||||| |||||||||||||| ||||||||||| ||||||||| ||| ||| |||||    
8888905 agggaaacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatggatcgaaaacc 8888983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 243
Target Start/End: Complemental strand, 15643954 - 15643840
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||| ||| |||| ||| |||||||| ||||||||||||  | ||||  |||||||    ||||||||||| ||||||||||||||||||    
15643954 tccaaggacgtatctggg-aataacgggttcgattcacaggggaacaacactaggccaatgcgcat----ctacgcatgagtcggattagtcgcccacct 15643860  T
224 ttggtgggtcggaaaccggt 243  Q
    || |||||||| ||||||||    
15643859 ttagtgggtcgaaaaccggt 15643840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 126 - 250
Target Start/End: Complemental strand, 24671990 - 24671865
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||| || ||||||||| ||| |||||||| |||||||||  ||| || ||| |||||||||||||||  |||||||||||| | || ||||    
24671990 caaggacgtatctggagaataccgggttctattcccagagggaacaacacttgaccagtgtgcatgcctctacgcacaagccggattagtagtccgcctt 24671891  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    || ||| ||||||| ||||| |||||    
24671890 tgatggttcggaaatcggtgtgaaag 24671865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 216
Target Start/End: Original strand, 9147285 - 9147378
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    |||||||||||| | |||||||| ||| ||||||||||| ||||||| ||  ||| || |||| ||||||||||||||| ||||||||||||||    
9147285 tccaaggacgtacctggggaatatcgggttcgattcccagggggaacgacacttgaccagtgcacatgcctctacgcataagccggattagtcg 9147378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 250
Target Start/End: Original strand, 10396496 - 10396584
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||| ||||||||  ||||| ||||||| |||||||||| ||||   ||| | |||||||||||||| ||||||    
10396496 aggggaacaacgtttggccagtgcgcatatctctatgcatgagtcggattagtcacccattattgataggtcggaaaccggtacgaaag 10396584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 9366509 - 9366423
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||| |||| |||||| ||||||||||||||||||| |||||||||||| || ||||||||||| |||   |||||| ||||||||    
9366509 ggggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagacg-ccacctttggtaggttaaaaaccgatgcgaaag 9366423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 249
Target Start/End: Complemental strand, 32157252 - 32157167
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||  ||| || |||||||| |||||||||||||||| ||||||||  ||| ||||||||| || |||||||||| ||||    
32157252 gggaacaacacttgaccagtgcgcatacctctacgcatgagccagattagtcatccatctttggtggatcagaaaccggtgtgaaa 32157167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 19230668 - 19230592
Alignment:
140 gggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    ||||||||||| |||||||  || |||||||||| |||| | ||  ||||||||||||||| |||||||||||||||    
19230668 gggaataccggattcgattttcaagggaacaacgcttggtcagtatgcatgcctctacgcacgagccggattagtcg 19230592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 33859405 - 33859318
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| || |||||||||||||||||||| || |||||||| | |  |  |||||||| ||| |||||| ||||||||    
33859405 ggggaacaacgtttgcccagtgcgcatgcctctacgcattagtcggattagccactaaaatttggtggatcgaaaaccgttgcgaaag 33859318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 241
Target Start/End: Original strand, 5332992 - 5333106
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||| ||||||||||||| | | |||||||| | | ||||||||  ||| || ||||||||| |||||| |||||||| |||||||||  || ||||     
5332992 aaggacttatccggggaatatcaggttcgattctcggcggaacaacacttgtccagtgcgcatgtctctacacatgagccagattagtcgttcatcttta 5333091  T
227 gtgggtcggaaaccg 241  Q
    ||||| || ||||||    
5333092 gtgggccgaaaaccg 5333106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 252
Target Start/End: Original strand, 21167422 - 21167488
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| | |||||||||||||||||| ||| ||||| ||| ||||| | |||||||||||||||||    
21167422 gcatgcatttacgcatgagccggattaatcgtccaccattgatgggttgaaaaccggtgcgaaagcc 21167488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 33939998 - 33940114
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||||| ||||||| || || ||||| |||| |||||||   ||  ||  ||||||||||||||| || ||||||||||||||| ||| ||||    
33939998 aaggacgtatccgaggaatactgggtttgattctcaggaggaacaatacttaaccattgcgcatgcctctacacacgagccggattagtcgtccatcttt 33940097  T
226 ggtgggtcggaaaccgg 242  Q
    |  |||||| |||||||    
33940098 gacgggtcgaaaaccgg 33940114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 240
Target Start/End: Complemental strand, 375058 - 374983
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||| ||||||||||| ||||||||||||||| |||||||  |||||||||  | | ||||| ||||||| |||||    
375058 ggaataacgtttggccagtgcgcatgcctctatgcatgagttggattagtcatctatctttgatgggtcgaaaacc 374983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 196 - 251
Target Start/End: Original strand, 5759660 - 5759715
Alignment:
196 acgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| || |||||||||||||||||||| ||||||||  ||| ||||||||||||    
5759660 acgcacgaaccggattagtcgcccaccttaggtgggtcaaaaatcggtgcgaaagc 5759715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 250
Target Start/End: Complemental strand, 3030696 - 3030642
Alignment:
196 acgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||| ||| |||||||||||| ||| ||||||||||||||||||| || |||||    
3030696 acgcacgagtcggattagtcgctcacatttggtgggtcggaaaccgatgtgaaag 3030642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 4596181 - 4596230
Alignment:
199 catgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 248  Q
    |||||||||||||||||| ||||| || |||||| ||||||| |||||||    
4596181 catgagccggattagtcgtccaccattagtgggttggaaaccagtgcgaa 4596230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 252
Target Start/End: Complemental strand, 13116156 - 13116127
Alignment:
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||    
13116156 tttggtgggtcggaaaccggtgcgaaagcc 13116127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 21872971 - 21873016
Alignment:
207 ggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| ||||||||| ||||||||||||| |||| ||||||    
21872971 ggattagtcgtccacctttgatgggtcggaaaccagtgcaaaagcc 21873016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 96; Significance: 5e-47; HSPs: 98)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 7246772 - 7246645
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||||||||| || ||||||||| || |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
7246772 tccaaggacgtacccggggaatactgggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacc 7246673  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||||||||||    
7246672 tttggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 38166012 - 38166140
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||||||||||| || || |||||||||||| ||||||| |||||| ||||||||| ||||||||| |||||||||||||||||||||    
38166012 tccaaggacgtatccggggaatactgggttggattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacc 38166111  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
38166112 tttggtgggtcggaaaccggtgcgaaagc 38166140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 29895772 - 29895899
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||| |||||    
29895772 tccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 29895871  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||||||| |||||||||||||||||||    
29895872 attggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 53599045 - 53599174
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||  ||||    
53599045 tccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacc 53599144  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||| |||||||||||||||||||||    
53599145 tttagtggatcggaaaccggtgcgaaagcc 53599174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 47078443 - 47078571
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||||| ||||||| |||||| |||| |||||||||||||| |||||||||||||||| ||||    
47078443 tccaaggacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcacc 47078542  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||||||||| ||||||||||    
47078543 attggtgggtcggaaaccagtgcgaaagc 47078571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 5472972 - 5472846
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||||| | || ||||| |||||||| ||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||    
5472972 caaggacgtatccggggaataccaggtttgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctt 5472873  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||| |||| |||||||||||    
5472872 tggtgggtcgaaaactggtgcgaaagc 5472846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 55921019 - 55921147
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||| | |||||||||||||| ||||||||||||||| ||||||  |||| | ||||||||||||||||| ||||||||||||| |||| ||||    
55921019 tccaaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacc 55921118  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
55921119 tttggtgggtcggaaaccggtgcgaaagc 55921147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 42722703 - 42722576
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||| |||||||| ||| ||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||  ||||    
42722703 tccaaggacgtacccgggaaataccgggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacc 42722604  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| |||||||| |||||||||||||||    
42722603 tttagtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 127 - 244
Target Start/End: Original strand, 8889010 - 8889128
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||||||||||||| ||||||||| ||||| ||||||  |||| | ||||||||| ||||||||||||||||||||||||| ||||||||    
8889010 aaggacgtatccggggaataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccaccttt 8889109  T
226 ggtgggtcggaaaccggtg 244  Q
    |||||||||||||||||||    
8889110 ggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 248
Target Start/End: Complemental strand, 295655 - 295534
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||||||||||||||||||| | |||||||||||| |||||||||||||||| ||||||||||||||||||| || || ||||||||| ||||| |||    
295655 aaggacgtatccggggaataccagattcgattcccagaggaacaacgtttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttg 295556  T
227 gtgggtcggaaaccggtgcgaa 248  Q
    ||||||  ||||||||||||||    
295555 gtgggtttgaaaccggtgcgaa 295534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 36145341 - 36145212
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||||||| ||||| |||  | |||||||||||||||| |||||||||||||||||| |||||    
36145341 tccaaggacgtacccggggaataccgggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacc 36145242  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||  |||||||||||||||||||||    
36145241 tttgatgaatcggaaaccggtgcgaaagcc 36145212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 49260791 - 49260662
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||||||||||||||| |  ||| ||||||| ||||||||||| |||||| ||||||||||||||||||| ||||||||||||||| |||||    
49260791 tccaaggatgtatccggggaatactgaattcaattcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacc 49260692  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||| |||||| ||||||    
49260691 tttggtgggtcggaaatcggtgcaaaagcc 49260662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 3159595 - 3159467
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||| ||||||||| ||||| | ||||||| ||||||| |||||| ||||||||||||||||||| ||||| |||||||||| ||||    
3159595 tccaaggacgtatccggagaataccgggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcacc 3159496  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     |||||||||||||||||||||| |||||    
3159495 attggtgggtcggaaaccggtgcaaaagc 3159467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 24166435 - 24166563
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  |||||||||| || ||||||||||| ||||| |||||||||||| ||||||||||||||||||| ||||| |||||||| ||||||    
24166435 tccaaggacgtactcggggaatactgggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacc 24166534  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| ||||||||||||||||||||    
24166535 tttgatggatcggaaaccggtgcgaaagc 24166563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 36262891 - 36262764
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||| ||||||||| |||||||||||||| ||||||| |||||| |||| |||||||||||||| ||| ||||||||||||||||||    
36262891 tccaaggacgtacccggagaataccgggttcgattcccaggg-aacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacct 36262793  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| ||||||  ||||||||||    
36262792 ttggtgggtcagaaaccaatgcgaaagcc 36262764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 38075418 - 38075546
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||| ||||||||| |||||||| |||||||| ||||| |||||| |||||||||||||||||||||||||| |||| | | |||||    
38075418 tccaaggacgtattcggagaataccgggttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacc 38075517  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||| |||||||||    
38075518 tttggtgggtcggaaaccgatgcgaaagc 38075546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 1940900 - 1940774
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||| |||| ||| ||||||||||||||| ||||||| ||||   ||||||||||||||||||| |||||||||||||||||||||    
1940900 tccaaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacc 1940804  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||| |||||||||||| ||||    
1940803 tttggtgggtcgaaaaccggtgcgatagcc 1940774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 2559292 - 2559419
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||||||| ||||||| | ||| ||||||||| |||||| |||||||||||||||||||  |||||||||| ||| |||||    
2559292 tccaaggacgtacctggggaataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacc 2559391  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||||||||||    
2559392 tttggtgggtcggaaaccggtgcgaaag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 40780984 - 40780861
Alignment:
127 aaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||| |||  |||| ||| |||||||| || ||||||||||| |||| | ||||||||||||||||||||||||||||||||||| ||||||||    
40780984 aaggacgtattcggaaaatatcgggttcgattctcaaggggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccttt 40780885  T
226 ggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||||||    
40780884 ggtgggtcggaaaccggtgcgaaa 40780861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 43468332 - 43468459
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| |||||||||||||| ||||||||||||||| ||||||| |||||| |||| |||  |||||||||||||||||||||||||||||||    
43468332 tccaagaacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcccacc 43468431  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
      |||||||||||| |||||||||||||    
43468432 agtggtgggtcggagaccggtgcgaaag 43468459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 52950067 - 52950195
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||| ||| ||||||||||||||| ||||||| |||||| ||||||||| |||||| ||||| || ||||||||| |||||    
52950067 tccaaggacgtacctggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacc 52950166  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||| |||||||||    
52950167 tttggtgggtcggaaaccgatgcgaaagc 52950195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 222
Target Start/End: Original strand, 1446811 - 1446910
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||| |||||    
1446811 tccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 1446910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 20128294 - 20128423
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||||||||||| || |||||||| |||||| ||||| | |||||| |||||||||||| |||||| ||||  ||||||||| |||||    
20128294 tccaaggacgtatccggggaatactgggttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccacc 20128393  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||| ||||||||||||||||||    
20128394 attggtgggtcagaaaccggtgcgaaagcc 20128423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 38168242 - 38168370
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||| | ||||||||| | | ||||||||| |||||| |||| ||||||||||||||||||||||||||||||  ||||    
38168242 tccaaggacgtacccggggaataccaggttcgattcctaagaggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacc 38168340  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||| |||||||||||||||||||    
38168341 tttagtgggttggaaaccggtgcgaaagcc 38168370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 130 - 251
Target Start/End: Complemental strand, 47682501 - 47682380
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    ||||||||||| |||||  |  || ||||| |||||||| ||||||||||| |||| |||| ||||||||| ||||||| ||||||||||||||||||||    
47682501 gacgtatccggagaatattgaatttgattctcaggggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtg 47682402  T
230 ggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||||||    
47682401 ggtcggaaaccggtgcgaaagc 47682380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 152 - 251
Target Start/End: Original strand, 16450313 - 16450413
Alignment:
152 ttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| ||||||| |||||| |||| |||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||    
16450313 ttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaag 16450412  T
251 c 251  Q
    |    
16450413 c 16450413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 27248413 - 27248538
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||| ||||||| ||||||||| |||||| |  |||||||||||||||| ||||| |||||||||||||||    
27248413 tccaaggacgtatccggggaataccgggttcgagtcccaggaggaacaacgcttggccag--cgcatgcctctacgcaggagccagattagtcgcccacc 27248510  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||| |||| ||||| |||| |||||    
27248511 tttggtaggtcagaaactggtgtgaaag 27248538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 48015199 - 48015071
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||| ||| |||||||||| |||||||||||| |||||||||| |||||| ||||||| ||||||||||| ||||||||||||| |||||      
48015199 tccaaagacgtacccgaggaataccgggttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcccaat 48015100  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| ||||||||||||||||||||    
48015099 tttgatggatcggaaaccggtgcgaaagc 48015071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 43458598 - 43458725
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||  ||||||||| || ||||||||||||| |||| |||| |||||| ||||||||||||||||| | ||||||||||||||| |||||    
43458598 tccaaggacgtatttggggaatactggattcgattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcgtccacc 43458697  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| || ||||||||||| ||||||||    
43458698 tttgatgagtcggaaaccgttgcgaaag 43458725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 13073523 - 13073649
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | || ||||||||  ||||||||||| ||||||||| |||||||| |||||||| ||||||||||||| || |||||||||   |||    
13073523 tccaaggacgtacctggagaataccgagttcgattcccatggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacc 13073622  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||||||||||||||    
13073623 tttggtgggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 141 - 250
Target Start/End: Original strand, 14124018 - 14124128
Alignment:
141 ggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||||||| | ||||||||||||||| |||||| ||||||| |||||||||||||||| || |||||||||||||||| |||| ||||||||| ||||||    
14124018 ggaataccaggttcgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaac 14124117  T
240 cggtgcgaaag 250  Q
    |||||||||||    
14124118 cggtgcgaaag 14124128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 15840060 - 15839934
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||   |||||||||||| ||||||||| ||  ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||  ||    
15840060 tccaaggacgtacttggggaataccgggttcgattcctagaagaataacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgcccttct 15839961  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| | ||| ||||||| |||||||||    
15839960 ttgataggttggaaaccagtgcgaaag 15839934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 6779196 - 6779324
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | || ||||||||| ||||||||||||||| ||||||   ||||| ||||||||||||||| ||||||||||||||||||| |||||    
6779196 tccaaggacgtacctggagaataccgggttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccggattagtcgtccacc 6779295  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||  |||||| ||| |||||||||    
6779296 tttggtgaatcggaacccgatgcgaaagc 6779324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 17080068 - 17080156
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||| ||| ||| ||||||||||||||||    
17080068 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc 17080156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 124 - 238
Target Start/End: Complemental strand, 20532535 - 20532420
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||| | || |||| ||||||||  ||||||| ||||| ||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||    
20532535 tccaaggccatacccggagaataccgagttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggataagtcgcccacc 20532436  T
223 tttggtgggtcggaaa 238  Q
    |||||||| |||||||    
20532435 tttggtggatcggaaa 20532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 16645117 - 16645231
Alignment:
138 cggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgga 236  Q
    ||||||||||||| |||||||  ||||  |||||||| |||||| ||| |||||||||||| |||||| | |||||||||||||||| ||||||||||||    
16645117 cggggaataccgggttcgattttcaggaagaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcgga 16645216  T
237 aaccggtgcgaaagc 251  Q
    |||||||||||||||    
16645217 aaccggtgcgaaagc 16645231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 4738631 - 4738732
Alignment:
152 ttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| ||||| ||||||||| || ||| ||||||||| |||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||    
4738631 ttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 4738730  T
251 cc 252  Q
    ||    
4738731 cc 4738732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 248
Target Start/End: Original strand, 21429286 - 21429411
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||||||| |||||| ||| |||||||   ||||| |||||||||| ||| ||||||||||||||||||| ||| | || |||||| |||||    
21429286 tccaaagacgtatccgaggaatatcgggttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacc 21429385  T
223 tttggtgggtcggaaaccggtgcgaa 248  Q
    ||||||||||||||||||||||||||    
21429386 tttggtgggtcggaaaccggtgcgaa 21429411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 15732574 - 15732446
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||| ||||||||| ||||||||  | ||||||||||  |||||| |||| |||||||||||||| | ||  |||||||||| || |    
15732574 tccaaggacgtatccggagaataccgggttcgattcatatggggaacaacacttggccagtgcacatgcctctacgcacgggctagattagtcgctcatc 15732475  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| ||||||||||||||||||||    
15732474 tttggtggatcggaaaccggtgcgaaagc 15732446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 30317221 - 30317345
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||  ||||||||| | | |||||||| ||| |||||||||| |||||| || || ||||||||||||| |||||| |||||||||||||||||    
30317221 aaggacgtactcggggaatatcaggttcgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccaccttt 30317320  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||| || |||||    
30317321 ggtgggtcggaaaccgatgtgaaag 30317345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 133 - 239
Target Start/End: Original strand, 3507265 - 3507371
Alignment:
133 gtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggt 232  Q
    |||||||| ||||| ||| ||||||||||| |||||||||| |||||  |||||| ||||||||| || ||||||||||||||| ||||||||||||| |    
3507265 gtatccggagaatatcgggttcgattcccaagggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggat 3507364  T
233 cggaaac 239  Q
    |||||||    
3507365 cggaaac 3507371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 173 - 250
Target Start/End: Original strand, 14567274 - 14567351
Alignment:
173 gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||||||||||||||||| |||||||||||||||| | |||||||||||||||||| |||||||||||    
14567274 gtttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 14567351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 40272457 - 40272340
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| || |||||||||||||| ||| ||||||| ||| ||||||||||| |||||| |||||||||||||||||||| || |||||| ||||  ||||    
40272457 tccaatgatgtatccggggaatatcgggttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcacc 40272358  T
223 tttggtgggtcggaaacc 240  Q
     |||||||||||||||||    
40272357 attggtgggtcggaaacc 40272340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 137 - 250
Target Start/End: Complemental strand, 42722491 - 42722378
Alignment:
137 ccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgga 236  Q
    |||||||||||||| || ||||||||||||||||||  ||| || |||||||| |||||| ||||||| ||||||||||| |||||  |||||||||| |    
42722491 ccggggaataccgggtttgattcccaggggaacaacacttgaccagtgcgcatacctctatgcatgagtcggattagtcgtccaccaatggtgggtcgaa 42722392  T
237 aaccggtgcgaaag 250  Q
    || |||||||||||    
42722391 aatcggtgcgaaag 42722378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 142 - 251
Target Start/End: Complemental strand, 48834807 - 48834698
Alignment:
142 gaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||||||| ||||||| ||||||||| ||   | |||| |||| ||||||||||  |||||| ||||||||||||| ||||||||||||||||||||||    
48834807 gaataccgggttcgatttccaggggaataatactaggccagtgcacatgcctctatacatgagtcggattagtcgcctacctttggtgggtcggaaaccg 48834708  T
242 gtgcgaaagc 251  Q
    ||||||||||    
48834707 gtgcgaaagc 48834698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 21192627 - 21192754
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||| |||||||  ||| |||||||| ||||| | || | ||||||||||| |||| ||||||||||||||||||| ||| ||||||| |||||||| |    
21192627 tccaatgacgtatttgggaaataccgggttcgagttcc-gaggaacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacat 21192725  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| |||| |||||||||||||||||    
21192726 ttggtgagtcgaaaaccggtgcgaaagcc 21192754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 29588721 - 29588849
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||  ||||| |||||||| ||||||||||||||||| ||| | |||||  ||||||||||||||||||| |||||||||||||   |||||    
29588721 tccaaagacgtgcccgggaaataccgggttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgcacgagccggattagttatccacc 29588820  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||||||| || |||||||||    
29588821 attggtgggtcggaaatcgatgcgaaagc 29588849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 126 - 249
Target Start/End: Original strand, 33647708 - 33647832
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||| |||||||||||| ||||||| |||||| |||||||| ||| || |||| ||| |||||||||| || || |||||||||  || |||    
33647708 caaggacgtatctggggaataccgggttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctt 33647807  T
225 tggtgggtcggaaaccggtgcgaaa 249  Q
    |||||| ||||||||||||||||||    
33647808 tggtggatcggaaaccggtgcgaaa 33647832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 31588672 - 31588798
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtt--tggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||| |||||||||  || || ||||||||| |||| ||||| |  ||||| ||||||||| |||||||||||||||||||||||||| ||| |    
31588672 aaggacgtattcggggaatattgggtttgattcccagaggaaacaacgctcttggccagtgcgcatgtctctacgcatgagccggattagtcgctcactt 31588771  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| |||||||||| ||||||||    
31588772 ttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 150 - 252
Target Start/End: Original strand, 35359747 - 35359850
Alignment:
150 gtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 248  Q
    |||||||||| |||||| ||||||||||| || ||||||||||||| |||||| ||  |||||||||||||||  | |||||||||||||||||||||||    
35359747 gtttcgattctcagggggaacaacgtttgaccagtgcgcatgcctcaacgcataagttggattagtcgcccactataggtgggtcggaaaccggtgcgaa 35359846  T
249 agcc 252  Q
    ||||    
35359847 agcc 35359850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 3574572 - 3574445
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |  ||||||||||  ||| |||||||||| |||||||  |||||| ||||||||||||||||||| ||| |||||||||||| ||||    
3574572 tccaaggacgtacctagggaataccgagttcaattcccagggagaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtcgctcacc 3574473  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || |||  |||||||||||||| |||||||    
3574472 ttaggt--gtcggaaaccggtgagaaagcc 3574445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 6032766 - 6032643
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||||||||||||| ||| |||  |||| |    ||| ||| || |||| |||||||||||| ||||||||||||||||| | ||||    
6032766 tccaaggacgtacccggggaataccgggttcaattttcaggaggt--acgcttgaccagtgctcatgcctctacgaatgagccggattagtcgtctacct 6032669  T
224 ttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||||||||    
6032668 ttggtgggtcggaaaccggtgcgaaa 6032643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 6862212 - 6862337
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||||||||||||||||| |||||||||| | |||| ||   |||| | ||||||||| |||||||||  || || ||||||| | |||||||    
6862212 caaggacgtatccggggaataccgggttcgattccctgtggaataatacttggtcagtgcgcatgtctctacgca-aagtcgaattagtcactcaccttt 6862310  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||||||||||||||||||||    
6862311 ggttggtcggaaaccggtgcgaaagcc 6862337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 46108713 - 46108794
Alignment:
160 ccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||||||||||| ||||||  ||||||||||||||||||||||||| ||||||||| |||| |||| ||||||||||||||    
46108713 ccaggggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccg 46108794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 41163008 - 41162880
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||||| |||||||  ||||||| |||| |||||||||  |||||| |||  ||||| |||| |||||||||| ||||||||||||||    
41163008 tccaaggacgtatccgggaaataccgagttcgatttccagagggaacaacacttggccagtgtacatgcttctatgcatgagccgaattagtcgcccacc 41162909  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| |||||||  || ||||||||    
41162908 tttgatggatcggaaattggagcgaaagc 41162880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 227
Target Start/End: Complemental strand, 41339521 - 41339417
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||| ||||||||| ||||| ||||| ||||||||||| |||||| ||| | ||||||||||||| ||| |||||||||||||||||    
41339521 tccaaggacgtacccggagaataccgggttcgactcccaaggggaacaacgcttggccagtgtgtatgcctctacgcacgagacggattagtcgcccacc 41339422  T
223 tttgg 227  Q
     ||||    
41339421 attgg 41339417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 167 - 250
Target Start/End: Complemental strand, 49952228 - 49952144
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgc-ccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||| | ||||||| ||||||||||||||||||||||||||||  |||||||| ||||| |||||||||||||||||    
49952228 aacaacgtttggtcagtgcgcacgcctctacgcatgagccggattagtcgcgtcacctttgatgggttggaaaccggtgcgaaag 49952144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 4736584 - 4736710
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||| ||| ||| |||||||||| ||| |||| ||| |||| ||||||||||||  || ||||||||||||| |  ||||| |||||||||||||| |    
4736584 caaggatgtacccgaggaataccgggttcaattctcagtggaaacaacgtttggccaatgtgcatgcctctacgtacaagccgaattagtcgcccaccgt 4736683  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||| |||||||||||||    
4736684 tggtgggtcggaaa-cggtgcgaaagcc 4736710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 141 - 251
Target Start/End: Original strand, 10541018 - 10541128
Alignment:
141 ggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||||| ||| ||||||| ||||||||| ||||| |||||| ||| ||||||||||||||| ||||| ||||| ||| ||||||||| ||| ||||||||    
10541018 ggaatatcgggttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaac 10541116  T
240 cggtgcgaaagc 251  Q
    ||||||||||||    
10541117 cggtgcgaaagc 10541128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 130 - 252
Target Start/End: Original strand, 20421765 - 20421887
Alignment:
130 gacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||||| ||||||||| |||| ||||| ||||||| ||||||  |||||| ||||||||||||||||||||||||| ||||| ||| ||| | ||| |    
20421765 gacgtatctggggaatactggtt-cgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgtccatcattgat 20421863  T
229 gggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||| || ||||||||    
20421864 gggtcggaaaccagttcgaaagcc 20421887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 24850752 - 24850625
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||||||| |||||| | ||| |||  ||||||||||||  ||| || |||||||||||||||||||||||| |||||| ||  |||||     
24850752 tccaaggacgtatccgggaaataccagattcaattatcaggggaacaacacttgaccagtgcgcatgcctctacgcatgagctggattattcatccacca 24850653  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||  ||| |||||||||| |||||||||    
24850652 ttattggatcggaaaccgatgcgaaagc 24850625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 166 - 252
Target Start/End: Original strand, 50485971 - 50486057
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||| |  |||||||||||||||| ||||||||||||||||||||| || ||||||||||||||| ||| ||||||    
50485971 gaacaacgattggccagaacgcatgcctctacgcacgagccggattagtcgcccaccattagtgggtcggaaaccgatgcaaaagcc 50486057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 242
Target Start/End: Original strand, 54946296 - 54946353
Alignment:
185 cgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgg 242  Q
    |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
54946296 cgcatgcctctacgcatgagccggattagtcgcccatcattggtgggtcggaaaccgg 54946353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 15829686 - 15829811
Alignment:
126 caaggacgtatccggggaata-ccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||||| ||||| || |||| ||||  |||||||| ||||  |||||| |||||||||| |||| ||||||||||||||||||  |||||     
15829686 caaggacgtatccggagaatatccagttt-gattttcaggggaatcaacacttggccagtgcgcatgcttctaggcatgagccggattagtcctccacca 15829784  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| || ||||||||||||||||    
15829785 ttggtggatcagaaaccggtgcgaaag 15829811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 142 - 250
Target Start/End: Complemental strand, 8064906 - 8064797
Alignment:
142 gaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||||| || ||||||||||| |||||| |||  ||| || ||||||||||||||||||||||||||||||||||| ||||| ||  | ||||| |||||    
8064906 gaatactgggttcgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattaataggtcgaaaacc 8064807  T
241 ggtgcgaaag 250  Q
    ||||| ||||    
8064806 ggtgcaaaag 8064797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 14858696 - 14858824
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||| ||| |||| ||||||||| |||| |||||||||| |  | | ||| || ||||||||| ||||||| | ||| | ||||| ||| ||||||    
14858696 tccaaggatgtacccggagaataccgggttcggttcccagggggatcaagcttgaccagtgcgcatgtctctacgtacgagtcagattattcgtccacct 14858795  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||| ||||||||||||||||||    
14858796 ttgatgggtcagaaaccggtgcgaaagcc 14858824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 251
Target Start/End: Complemental strand, 14597976 - 14597898
Alignment:
173 gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| ||||||||||||||||||| || | |||||||||| ||||||||| ||| ||| |||||||||| |||||    
14597976 gtttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 14597898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 164 - 250
Target Start/End: Complemental strand, 37369127 - 37369041
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| || ||| ||||||||||||||| ||| ||||| ||||||||||  ||||||  |||||||||| ||||||||    
37369127 gggaacaacgtttgtccagtgtgcatgcctctacgcacgagtcggataagtcgcccactattggtgaatcggaaaccgatgcgaaag 37369041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 166 - 251
Target Start/End: Original strand, 8424582 - 8424667
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||| ||||||||||||||| ||| |||||  |||| |||| || ||||||||||||| ||| || |||||||||    
8424582 gaacaacgtttggccagtgcgcatgcctctatgcacgagccaaattaatcgctcatctttggtgggtcgaaaatcgatgcgaaagc 8424667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 18531544 - 18531633
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||  |||| | ||||||||||||| | ||| || || ||||| ||| |||||||| ||||||||||||||||||||||||||    
18531544 ggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaagcc 18531633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 138 - 250
Target Start/End: Original strand, 45721085 - 45721198
Alignment:
138 cggggaataccggtttcgattcccaggggaac-aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgga 236  Q
    ||||||||||||| ||| |||  ||||||||  || ||||||||  ||||| ||||||||||||  || ||||||||||| ||||||||  ||||| |||    
45721085 cggggaataccgggttccattttcaggggaaataatgtttggccactgcgcgtgcctctacgcacaagtcggattagtcgtccacctttaatgggttgga 45721184  T
237 aaccggtgcgaaag 250  Q
    ||||||||||||||    
45721185 aaccggtgcgaaag 45721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 48317359 - 48317279
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    ||||||||| |||| | ||| | ||||||||||||| ||||||||||||||||||||| ||| ||||| ||||||| ||||    
48317359 ggaacaacgcttggtcagtgtgtatgcctctacgcacgagccggattagtcgcccaccgttgatgggttggaaaccagtgc 48317279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 14567947 - 14568067
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||  |||||||||| | |||||||| ||||| ||| |||| ||| || |||| ||| |||||||||| ||| ||||||||||||      |     
14567947 aaggacgtatttggggaataccaggttcgattctcagggagaataacgcttgaccagtgcacatacctctacgcacgagtcggattagtcgc------tg 14568040  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||||||    
14568041 ggtgggtcggaaaccggtgcgaaagcc 14568067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 243
Target Start/End: Original strand, 37194848 - 37194915
Alignment:
176 tggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggt 243  Q
    ||||| |||| |||||||||||||||||||||||||||| ||||  | ||| ||||||||||||||||    
37194848 tggccagtgcacatgcctctacgcatgagccggattagttgcccgtcattgatgggtcggaaaccggt 37194915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 2686512 - 2686454
Alignment:
192 ctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||| ||||||||| |||||||| |||||||| |||||| |||||||||||||||||    
2686512 ctctacacatgagccgaattagtcgtccaccttttgtgggttggaaaccggtgcgaaag 2686454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 7000509 - 7000631
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  ||||||||||||  |||||||||||||  |||||||| ||||||  ||    |||||||||||| ||||| |||||||||| || |    
7000509 tccaaggacgtactcggggaataccgagttcgattcccaggaagaacaacgcttggccaatg----tgcctctacgcacgagccagattagtcgctca-c 7000603  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| | | |||||||||||||||    
7000604 tttggtggattgaaaaccggtgcgaaag 7000631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 55005432 - 55005317
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||||| ||| |||||||  |||||||| |||||||| ||||| ||| ||  ||||||||||||||||||  || |||||||||||||||      
55005432 tccaaagacgtatctgggaaataccgaattcgattcgcaggggaaacaacgcttgaccattgcgcatgcctctacgcacaagtcggattagtcgccca-- 55005335  T
223 tttggtgggtcggaaacc 240  Q
     ||| |||||||||||||    
55005334 attgatgggtcggaaacc 55005317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 126 - 249
Target Start/End: Original strand, 7741912 - 7742036
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||| |||||| || |||||| ||| ||| | || |||||| ||||||| |||||| |||| |||||||||||||| || || ||||||||| ||| |||    
7741912 caagtacgtattcgaggaatatcgggttccaatctcaggggtaacaacgcttggccagtgcacatgcctctacgcacgatccagattagtcgtccatctt 7742011  T
225 tggtgggtcggaaaccggtgcgaaa 249  Q
    |||||  ||| |||| |||||||||    
7742012 tggtgaatcgaaaactggtgcgaaa 7742036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 252
Target Start/End: Complemental strand, 25406620 - 25406560
Alignment:
192 ctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||  | |||||||||  |||||||| |||||||||||||||||||||||||    
25406620 ctctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaaagcc 25406560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 221
Target Start/End: Original strand, 20354665 - 20354720
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    |||||||| |||||  ||||||||||||||||||||||| ||||||||||| ||||    
20354665 gaacaacgcttggctagtgcgcatgcctctacgcatgagtcggattagtcgtccac 20354720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 249
Target Start/End: Complemental strand, 48352592 - 48352509
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||| |||| ||||||||  | || ||||||||||||||| ||| ||||| || |||||| ||| ||||||||    
48352592 gaacaacgtttggccagtgcacatgcctcctcacacgagccggattagtcgtccatctttgatgagtcggagaccagtgcgaaa 48352509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 12703668 - 12703542
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||  || ||||||| |  ||||||| |||| |||||||||| ||| || ||| | ||| |||||||||| |||||||||||||||||| ||||    
12703668 aaggacgtactcgaggaatactgagttcgatttccagtgggaacaacgcttgaccagtgtgtatgtctctacgcataagccggattagtcgcccatcttt 12703569  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
       || |||||||||| || |||||||    
12703568 aaaggatcggaaaccgatgtgaaagcc 12703542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 249
Target Start/End: Complemental strand, 26237520 - 26237422
Alignment:
152 ttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||| |||||||| |||||||||  | ||||| ||| || |||||||||| ||||||||| | ||||| ||| |||||||||||| | |||||||    
26237520 ttcgattctcaggggaaacaacgtttgatcagtgcgtatgtctttacgcatgagtcggattagtagtccaccattgatgggtcggaaactgatgcgaaa 26237422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 27531722 - 27531668
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| |||| |||||| |||||||||||||||||||| |||||| ||||||    
27531722 cgcatgagtcggaatagtcgtccacctttggtgggtcggaagccggtgtgaaagc 27531668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 190
Target Start/End: Complemental strand, 27531783 - 27531717
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatg 190  Q
    |||||||||||| || ||||||||||| ||||||||||| |||||||| | ||||||  ||||||||    
27531783 tccaaggacgtacccagggaataccgggttcgattcccatgggaacaatgcttggccaatgcgcatg 27531717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 38841431 - 38841366
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||||||||||||| ||||||||||| ||| ||||||| | ||||||| || |||||||||    
38841431 gcatgtctctacgcatgagtcggattagtcgtccatctttggtagttcggaaatcgatgcgaaagc 38841366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 17946490 - 17946602
Alignment:
139 ggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||| | | |||||||  |||||||||||   ||| || |||||||||| ||||| |||||| | ||||||| | |||| ||||||| |||| |||    
17946490 ggggaatagcagattcgattttcaggggaacaattcttgaccagtgcgcatgcttctacacatgagtcagattagttgtccacttttggtgagtcgaaaa 17946589  T
239 ccggtgcgaaagc 251  Q
    ||| |||||||||    
17946590 ccgttgcgaaagc 17946602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 250
Target Start/End: Complemental strand, 24479043 - 24478983
Alignment:
190 gcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| || ||||||||||| ||||||||| ||||||| ||||||||| || ||||||    
24479043 gcctctacacacgagccggattaatcgcccaccgttggtggatcggaaaccagtacgaaag 24478983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 212 - 251
Target Start/End: Original strand, 1461656 - 1461695
Alignment:
212 agtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| |||||||||| |||||||||||||||||    
1461656 agtcgcccaccattggtgggtcagaaaccggtgcgaaagc 1461695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 4986237 - 4986307
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| |||| || ||| ||| ||||||||||| | ||||||| |||||| ||||| ||||||||||||    
4986237 gtgcgcacgcctttatgcacgagacggattagtcgtctacctttgatgggtcagaaactggtgcgaaagcc 4986307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 245
Target Start/End: Original strand, 13552155 - 13552209
Alignment:
191 cctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    |||||||||||||||||||||||||  ||||| ||| ||| | ||||||||||||    
13552155 cctctacgcatgagccggattagtcatccaccattgatggataggaaaccggtgc 13552209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 33176013 - 33176127
Alignment:
138 cggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgga 236  Q
    ||||||||| ||| |||||||  |||||| ||||||||||| ||  || ||||| |  | | |||||| | ||||||||| |||||||||||| || |||    
33176013 cggggaatatcggattcgattttcagggggaacaacgtttgtccaatgtgcatgtcgattcacatgaggcagattagtcgtccacctttggtgagttgga 33176112  T
237 aaccggtgcgaaagc 251  Q
    |||| ||||||||||    
33176113 aaccagtgcgaaagc 33176127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 23788426 - 23788475
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    |||||||||| | | ||||||||||||||||||| |||| ||||||||||    
23788426 aacaacgtttagtcagtgcgcatgcctctacgcacgagctggattagtcg 23788475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 250
Target Start/End: Complemental strand, 2687388 - 2687304
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||| | |||||||||| |||||  || || ||||||||||   || |  ||||||||||||||||||||| ||||    
2687388 gaacaacgtttggtcagtgcgcatgcttctacatataagtcggattagtcattcatcagtggtgggtcggaaaccggtgcaaaag 2687304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 196 - 252
Target Start/End: Original strand, 13436862 - 13436918
Alignment:
196 acgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||  |||||||| ||||||||| || ||| ||||||||||| ||||||    
13436862 acgcatgagcccaattagtcgtccacctttgatgtgtcagaaaccggtgcaaaagcc 13436918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 31635814 - 31635758
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||| |||||||||||||  |||||| ||||||| ||||| |||||| ||||    
31635814 gtgcgcatgtctctacgcatgagttggattaatcgcccatctttgatgggtcagaaa 31635758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 53354576 - 53354632
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||||||||||||||| |  |||||||||||  || ||||| |||||||||||    
53354576 gtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtcggaaa 53354632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 251
Target Start/End: Complemental strand, 55703834 - 55703750
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| | ||||||||| ||| || || ||||||||||||| | ||| ||||  ||||||| ||| ||||| ||||||    
55703834 aacaacgtttggtcagtgcgcatgtctcaacccacgagccggattagttgtccatcttttatgggtcgaaaatcggtgtgaaagc 55703750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 94; Significance: 7e-46; HSPs: 74)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 15884681 - 15884556
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| | |||||||||||| |||||||||||||||||||||  |||||  ||||||||||||||||||| ||||||||||||||||||||||    
15884681 tccaaggacgtacctggggaataccgggttcgattcccaggggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacct 15884582  T
224 ttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||||||||    
15884581 ttggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 142 - 249
Target Start/End: Complemental strand, 4479403 - 4479296
Alignment:
142 gaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||    
4479403 gaataccggattcgattcccaggggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccg 4479304  T
242 gtgcgaaa 249  Q
    ||||||||    
4479303 gtgcgaaa 4479296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 45521153 - 45521280
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||| ||| |||||||||||||| |||||||||||||||||||||  |||  | |||||||||||||||||||||||||||||||||||| |||||    
45521153 tccaaggatgtacccggggaataccgggttcgattcccaggggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacct 45521252  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||||||||||||||||||||||||    
45521253 ttgatgggtcggaaaccggtgcgaaagc 45521280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 6100458 - 6100585
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||||||| |||||||||||||||||||||||  ||||||    
6100458 caaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctt 6100557  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    | |||||||| |||||| ||||||||||    
6100558 tagtgggtcgaaaaccgctgcgaaagcc 6100585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 10927592 - 10927719
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| |||||||||||||| ||||||||| ||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||  ||||||    
10927592 caaggacgtacccggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctt 10927691  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    | ||||||||||||||| ||||||||||    
10927692 tagtgggtcggaaaccgatgcgaaagcc 10927719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 14666197 - 14666068
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||||||| ||||  |||||| |||||||||||||||||||  |||| ||||||||||||||     
14666197 tccaaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccaca 14666098  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||||| |||||||||||||||||    
14666097 gttggtgggtcgaaaaccggtgcgaaagcc 14666068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 2467244 - 2467115
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||| ||||||| ||||||  |||||| ||||||||| ||||| ||||||||||||||||||| ||||     
2467244 tccaaggacgtatccggggaataccgggttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcgtccaca 2467145  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||| ||||||||||||||||||||||    
2467144 attggtgtgtcggaaaccggtgcgaaagcc 2467115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 14846563 - 14846688
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||| |||||||||||||| |||||||| ||||||||||| | |||| | ||||||||||||||||||||||| | ||| ||||| |||||||||    
14846563 aaggacgtacccggggaataccgggttcgattctcaggggaacaatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttg 14846662  T
227 gtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||| |||||||||||||    
14846663 gtgggtcggaaatcggtgcgaaagcc 14846688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 8141086 - 8141214
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||| ||||||| ||||||||| ||||| |||||| |||||||||||||||||||||||| | |||||||| ||||     
8141086 tccaaggacgtattcggggaataccgggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccaca 8141185  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| ||||||| |||||||||    
8141186 tttggtgggtcagaaaccgatgcgaaagc 8141214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 133 - 251
Target Start/End: Original strand, 43032894 - 43033013
Alignment:
133 gtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtggg 231  Q
    ||||| ||| |||| ||| ||||||||||||||| ||||||| |||||| |||||||||||||||| || ||||||||||||||||||||||||||||||    
43032894 gtatctgggaaatatcggattcgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtggg 43032993  T
232 tcggaaaccggtgcgaaagc 251  Q
    || |||||||||||||||||    
43032994 tcagaaaccggtgcgaaagc 43033013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 2964060 - 2964189
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| |||||||||||||  ||||||||| | | ||||||||| ||||||  || ||||||||||||||| || ||||||||||||||||||    
2964060 tccaagaacgtacccggggaataccgtgttcgattccgatgaggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacc 2964159  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
2964160 tttggtgggtcagaaaccggtgcgaaagcc 2964189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 245
Target Start/End: Original strand, 11785900 - 11786021
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||||||||||||| ||||||||| |||||| |||||||||| | ||| ||||||||||||||||||||| ||||| |||| || ||    
11785900 tccaaggacgtacccggggaataccggattcgattccaaggggagcaacgtttgggcagtgtgcatgcctctacgcatgagccagattaatcgctcatct 11785999  T
224 ttggtgggtcggaaaccggtgc 245  Q
    ||| ||| ||||||||||||||    
11786000 ttgatggatcggaaaccggtgc 11786021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 8997668 - 8997542
Alignment:
126 caaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||| ||| ||||||||||||  ||||||||| | |||||||||||||| ||| || ||||||||| |||||||||||| |||||||||  || |||    
8997668 caaggacatattcggggaataccgtgttcgattcctaaggggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctt 8997569  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||    
8997568 tggtgggtcggaaaccggtgcgaaagc 8997542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 126 - 251
Target Start/End: Original strand, 43027291 - 43027417
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||| ||||||  ||||||||| || ||||||||||||| ||||||||| ||| ||  |||||||||||||||||||||||||||||||||| ||| |||    
43027291 caagaacgtatttggggaatactgggttcgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcgtccatctt 43027390  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    || |||||||||||||| |||||||||    
43027391 tgatgggtcggaaaccgatgcgaaagc 43027417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 9860122 - 9859993
Alignment:
124 tccaaggacgtatccgggg-aataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    ||||||||||||||||||| |||||||| ||||||||||||||| ||||||  |||||| ||| |||||||||||| |||||||| ||||||||| ||||    
9860122 tccaaggacgtatccgggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagccagattagtcgtccac 9860023  T
222 ctttggtgggtcggaaaccggtgcgaaagc 251  Q
    | ||||||| |||||||||| ||| |||||    
9860022 cattggtggatcggaaaccgatgcaaaagc 9859993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 16893921 - 16894048
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||||||||||||| ||| |||||||| || |||||| |||| |||||| || | ||||||| ||||||||||||||||| ||||||||||    
16893921 tccaatgacgtatccggggaatatcgggttcgattcacagggggaataacgcttggccagtacacatgcctttacgcatgagccggatt-gtcgcccacc 16894019  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| |||||||||||||||||||||||    
16894020 tttggt-ggtcggaaaccggtgcgaaagcc 16894048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 134 - 250
Target Start/End: Original strand, 18374004 - 18374121
Alignment:
134 tatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggt 232  Q
    |||||||| |||||| | |||||||| ||||| |||||||| ||| || ||||||||||||||||||||||||||||||||||| ||| |||||||||||    
18374004 tatccgggaaataccaggttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggt 18374103  T
233 cggaaaccggtgcgaaag 250  Q
    || |||||||||| ||||    
18374104 cgaaaaccggtgcaaaag 18374121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 24837226 - 24837355
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| |||||||||||||  |||||||||||||| |||||||| |||||| |||  |||||||||| ||| |||| |||||||||| |||||    
24837226 tccaagtacgtacccggggaataccgtgttcgattcccagggagaacaacgcttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacc 24837325  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||||| ||||||||||||    
24837326 tttggtggatcggaaactggtgcgaaagcc 24837355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 583798 - 583925
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||  || | |||||||| ||||||||| |||| ||||||| ||| || ||||||||||||||||||||||| ||||||||||||||||||    
583798 tccaaggacgtactcgagaaataccgggttcgattcctaggg-aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacct 583896  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||| |  ||||||||||||||||||    
583897 ttgatggattagaaaccggtgcgaaagcc 583925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 241
Target Start/End: Complemental strand, 1013103 - 1012985
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| || | ||||||||||||||||||||| |||| |||  ||||    
1013103 tccaaggacgtatccggggaataccgggttcgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcacc 1013004  T
223 tttggtgggtcggaaaccg 241  Q
    ||| |||| ||| ||||||    
1013003 tttagtggatcgaaaaccg 1012985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 137 - 233
Target Start/End: Original strand, 6042818 - 6042915
Alignment:
137 ccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtc 233  Q
    |||||||||||||| ||||||||||| ||||||||||| |||||| ||||||||||||  |||||||||||||||||||||||||||  |||||||||    
6042818 ccggggaataccgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggattagtcgcccaccactggtgggtc 6042915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 3418639 - 3418511
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||| ||| |||||||   ||| ||||||||  |||||| |||||||||| |||||||||||| | ||||||||| |||||    
3418639 tccaaggacgtatctggggaatatcgggttcgatttttaggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacc 3418540  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||||||| |||||||||||||||||    
3418539 tttagtgggtcagaaaccggtgcgaaagc 3418511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 17981425 - 17981553
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| ||||| |||||||| ||||||||||||||| ||||||  ||| || ||| ||||||||||||||| ||| || |||||| ||||| |    
17981425 tccaaggatgtacccgggaaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcgaattagttgcccagc 17981524  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||| |||||||||||||||||||||    
17981525 tttggtgagtcggaaaccggtgcgaaagc 17981553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 44893404 - 44893277
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||| ||| | ||||| ||||| | |||||| ||| ||||||||||||||| ||||||||||| |||| ||||    
44893404 tccaaggacgtacccggggaataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacc 44893305  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||| |||||||||||||||||| ||||    
44893304 cttgatgggtcggaaaccggtgcaaaag 44893277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 13085508 - 13085633
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| |||||||| ||| ||||||||||||| ||| ||| |||| |||||||||| ||||| ||||| ||||||| |    
13085508 tccaaggacgtatccggggaataccgggttcgattctcagagggaacaacgtttagccagtgtgcatacctctacgcacgagccagattaatcgcccatc 13085607  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
        |||||||||||||||||||||||    
13085608 -aaagtgggtcggaaaccggtgcgaaa 13085633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 10535529 - 10535401
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||||| |||||||  | ||| |||  |||||||||| || ||| || ||||||||| ||| |||||||||||| ||||||||  |||||    
10535529 tccaaggacgtatccgaggaatacatggttcaattttcaggggaacaccgcttgaccagtgcgcatgtctccacgcatgagccgaattagtcgttcacct 10535430  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||  ||||||||| ||||||||||||    
10535429 ttggtaagtcggaaactggtgcgaaagcc 10535401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 164 - 252
Target Start/End: Complemental strand, 11298352 - 11298264
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||  || ||| ||||||||||||||| |||||||||  |||| |||| ||||||||||||||||||||||||||||||||||    
11298352 gggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaagcc 11298264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 124 - 206
Target Start/End: Complemental strand, 38922540 - 38922457
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagcc 206  Q
    |||||||||||| |||||||||||||| |||||||||||| |||||||||| |||||| |||||||||||| |||||| |||||    
38922540 tccaaggacgtacccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctttacgcacgagcc 38922457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 163 - 245
Target Start/End: Complemental strand, 13358042 - 13357960
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    ||||||||||||||||||  || ||||||||||| ||| ||||||||||||||| || ||||| |||||||||||||||||||    
13358042 ggggaacaacgtttggccaatgtgcatgcctctatgcacgagccggattagtcgtccccctttagtgggtcggaaaccggtgc 13357960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 26570911 - 26571037
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||| ||||| ||| |||| ||| ||| ||||| ||||| ||||||| |||||| ||| | |||| |||||||||||||||||||||||| ||||||||    
26570911 aaggatgtatctgggaaatatcgggttcaattcctagggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccaccttt 26571010  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    | || ||||||||||| || |||||||    
26571011 gatgagtcggaaaccgatgtgaaagcc 26571037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 36662389 - 36662515
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||| || |||||| ||| |||||||  |||||||||||   || ||| ||||||||||||||||| |||| |||||||||||| |||| |    
36662389 tccaaggacgtatacgaggaatatcgggttcgattttcaggggaacaatacttagccagtgcgcatgcctctacgtatgaaccggattagtcgtccactt 36662488  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||  ||| |||||||||| ||||||||    
36662489 ttaatggatcggaaaccgatgcgaaag 36662515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 126 - 230
Target Start/End: Complemental strand, 33401923 - 33401818
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||  ||||||||||||| |||||||  |||||| ||||||  ||| || ||| ||||||||||||||||||| |||||||||||||||||||    
33401923 caaggacgtactcggggaataccgggttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgcccacctt 33401824  T
225 tggtgg 230  Q
    | ||||    
33401823 tagtgg 33401818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 16291289 - 16291201
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||  |||||| || | |||||||||| |||||||| ||||||||||| |||||||||||||||| ||||||||| ||||||    
16291289 ggggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaaagc 16291201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 68224 - 68097
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||   ||||||| | ||| |||||||| |||| |||||||||||||||| ||  |||||||| ||| || ||||||||||| |||  ||||    
68224 tccaaggacgtgctcggggaagatcgggttcgattctcaggaggaacaacgtttggccagtatgcatgcctttacacacgagccggattaatcgttcacc 68125  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| |||||||||||||||||| ||||    
68124 tttgatgggtcggaaaccggtgcaaaag 68097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 249
Target Start/End: Complemental strand, 7673743 - 7673657
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||||  ||| ||||||||||||||| ||||||||||  ||||||| |||| |||| ||| ||||||||||||||    
7673743 ggggaacaacgtttggctagtgtgcatgcctctacgcacgagccggatttttcgcccatctttagtggatcgaaaaccggtgcgaaa 7673657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 252
Target Start/End: Complemental strand, 22212600 - 22212512
Alignment:
165 ggaacaacg-tttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| |||| || || ||||||| |||||||| | |||||||||||||| |||||||||||| ||| |||||||||||||||||    
22212600 ggaacaacgctttgaccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaagcc 22212512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 166 - 250
Target Start/End: Original strand, 23895595 - 23895679
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| |||||| |||||||| |||||||||| |||  |||||| ||| ||||||||| |||||||||||| ||||||||||    
23895595 gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag 23895679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 182 - 249
Target Start/End: Complemental strand, 3379879 - 3379812
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||| ||||||| ||||||| ||||||||||| |||| |||||||||||||||| ||||||||||    
3379879 gtgcgcacgcctctatgcatgagtcggattagtcgtccacttttggtgggtcggaaatcggtgcgaaa 3379812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 33935844 - 33935761
Alignment:
141 ggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||| ||||||||| |||| |||||||  |||||| |||||||||||| |||||||||| |||||||||||| |||||    
33935844 ggaataccggattcgattcctagggagaacaacacttggccagtgcgcatgcctatacgcatgagtcggattagtcgctcacct 33935761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 8803097 - 8803167
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||  |||||||||| ||||||||||||||||||| |  ||||||||||||||||| ||||||||||    
8803097 gtgcgcagacctctacgcacgagccggattagtcgcccatcaatggtgggtcggaaaccgatgcgaaagcc 8803167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 17845717 - 17845841
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||| |||  |||||||||| ||||| ||||||||||||||||||  |||||  |||| ||| ||||||||||  ||    |||| ||||||||||    
17845717 tccaaggatgtactcggggaatactggttt-gattcccaggggaacaacacttggctagtgcacattcctctacgcacaagtttaattaatcgcccacct 17845815  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    | |||||||||||||||||||||||||    
17845816 t-ggtgggtcggaaaccggtgcgaaag 17845841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 252
Target Start/End: Original strand, 27975938 - 27976004
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||| |||||||||||| |||||||||||| ||||||| | ||||| ||||||||||    
27975938 gcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 27976004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 252
Target Start/End: Original strand, 28033207 - 28033273
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||| |||||||||||| |||||||||||| ||||||| | ||||| ||||||||||    
28033207 gcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 28033273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 170 - 251
Target Start/End: Original strand, 3692864 - 3692945
Alignment:
170 aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| | |||||||| ||||||||||||||||| |||| |||  |||||||||| ||||| |||||||| |||||||    
3692864 aacgtttggtcagtgcgcatacctctacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggtacgaaagc 3692945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 216
Target Start/End: Original strand, 22810064 - 22810154
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    ||||||||||||||||| ||| | ||| |||||||||| ||||||||||| |||| | |||||||||  ||| |||||||||| |||||||||    
22810064 tccaaggacgtatccggagaacatcgggttcgattccctggggaacaacgcttggtcagtgcgcatg--tcttcgcatgagccagattagtcg 22810154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 132 - 208
Target Start/End: Complemental strand, 34613896 - 34613819
Alignment:
132 cgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccgg 208  Q
    ||||||||||||||| ||| ||||||||||||| |||||||||| ||||| || ||||||||||||  ||||||||||    
34613896 cgtatccggggaatatcgggttcgattcccaggaggaacaacgtctggccagtacgcatgcctctatacatgagccgg 34613819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 183 - 243
Target Start/End: Complemental strand, 24938628 - 24938568
Alignment:
183 tgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggt 243  Q
    ||||||||||||||||||||| |||||||||||  ||||||||| ||| ||||||||||||    
24938628 tgcgcatgcctctacgcatgaaccggattagtcatccacctttgatggatcggaaaccggt 24938568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 252
Target Start/End: Original strand, 993232 - 993301
Alignment:
183 tgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||||||| |||||  |||||||||| ||||||||||||| || |||| |||||||||||||    
993232 tgcgcatgtctctacgtatgagttggattagtcgtccacctttggtggttcagaaatcggtgcgaaagcc 993301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 240
Target Start/End: Original strand, 3567928 - 3568005
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    ||||||||||  ||| || |||| ||| ||||||||||||||||  |||||||  |||||||||||||||||||||||    
3567928 ggggaacaacacttgaccagtgcacatacctctacgcatgagccaaattagtcatccacctttggtgggtcggaaacc 3568005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4772094 - 4772049
Alignment:
206 cggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||    
4772094 cggattagtcgtccacctttggtgggtcggaaaccggtgcgtaagc 4772049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 224
Target Start/End: Original strand, 18091428 - 18091485
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||| || ||||||||||||||||||| ||| || ||||||||||||||||    
18091428 aacaacgtttgaccagtgcgcatgcctctacgcacgaggcgaattagtcgcccacctt 18091485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 237
Target Start/End: Original strand, 29933766 - 29933870
Alignment:
133 gtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtggg 231  Q
    |||||||| |||||| |||| |||||||||||| |||||||  ||| || |||  |||||||||||| |||||||||||||||||| | |||||| || |    
29933766 gtatccggagaatacgggtt-cgattcccagggagaacaacacttgaccagtgtacatgcctctacgtatgagccggattagtcgcacccctttgatgag 29933864  T
232 tcggaa 237  Q
    ||||||    
29933865 tcggaa 29933870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 39969982 - 39969913
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||| |||||| | ||||||||||||| | ||| ||| |||||||||| |||||||||    
39969982 gtgcgcatgcctctacacatgagtcagattagtcgcccatcattgatggatcggaaaccgatgcgaaagc 39969913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 34710693 - 34710565
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  |||  |||||||| ||||||||||||||| ||||||  |||||  |||||||||||| ||| ||  || |||| |||||| ||| |    
34710693 tccaaggacgtactcggaaaataccggattcgattcccaggggaaacaacacttggctagtgcgcatgcctttacacacaagtcggactagtcgtccatc 34710594  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||| ||||| || |||||||    
34710593 attggtgggtcgaaaaccagtccgaaagc 34710565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 6940542 - 6940668
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||||||||  |||| ||| ||||||| ||||| ||||||||| |||||  |||||||| | | ||| |||||| || |||||||  |||||    
6940542 tccaaggaggtatccggaaaatatcgggttcgatttccaggtggaacaacgcttggctagtgcgcatactt-tacacatgagtcgaattagtcatccacc 6940640  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||| |||||||| || |||||    
6940641 tttggtgggtaggaaaccgatgtgaaag 6940668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 8587025 - 8586978
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggat 210  Q
    ||||||||||| |||||| |||||||| ||||||||||||||||||||    
8587025 ggggaacaacgcttggccagtgcgcatacctctacgcatgagccggat 8586978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 241
Target Start/End: Complemental strand, 13831096 - 13831022
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||||||||| ||  ||||||||||||||| ||| || |||||||||| |||| ||||||| ||| ||||||||    
13831096 aacaacgtttgaccaatgcgcatgcctctacacataagtcggattagtcacccatctttggtaggttggaaaccg 13831022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 22958754 - 22958859
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | | |||||| ||  |||||||  ||| |||||||| | |||| | ||| ||||| ||||| ||||||||||||||||||| |||||    
22958754 tccaaggacgtacctgtggaatatcgaattcgattttcagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacc 22958853  T
223 tttggt 228  Q
    ||||||    
22958854 tttggt 22958859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 200
Target Start/End: Original strand, 34846798 - 34846874
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgca 200  Q
    |||||||||||| ||||| |||||||| ||||||||||| || |||||||| |||||| ||  |||||||||||||||    
34846798 tccaaggacgtacccggg-aataccgggttcgattcccatggtgaacaacgcttggccagtatgcatgcctctacgca 34846874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 2209770 - 2209894
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||| || | |||||| ||| || |||||  ||||||| |||| ||||| | ||||||||| | |||||||| ||  ||||||||||| |||| ||    
2209770 aaggacgtgtctgaggaatatcgggtttgattcttaggggaaacaacatttggtcagtgcgcatgtccctacgcataagttggattagtcgctcaccatt 2209869  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
    ||| |||| ||||| ||||||||||    
2209870 ggtaggtcagaaactggtgcgaaag 2209894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 217
Target Start/End: Complemental strand, 22276528 - 22276493
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgc 217  Q
    |||||||||||||||||||| |||||||||||||||    
22276528 gtgcgcatgcctctacgcataagccggattagtcgc 22276493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 249
Target Start/End: Complemental strand, 28738218 - 28738151
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||| || |||||| ||||| ||| ||| ||||||| |||||  |||||||||||||||||||    
28738218 gtgcgcatgtctttacgcacgagccagatcagttgcccaccattggtatgtcggaaaccggtgcgaaa 28738151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 38235889 - 38236016
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||| | |||||| |||||||||||| | || ||| | ||||||  ||| ||||  |||| ||| |||| |||||||||||||||     
38235889 tccaaggacgtacctgggaagtaccggattcgattcccagagaaaacaatgcttggccattgcacatgattctatgcacgagcgggattagtcgcccact 38235988  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||||||||| |||||||| ||| ||||    
38235989 gttggtgggttggaaaccgatgctaaag 38236016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 238
Target Start/End: Complemental strand, 43349402 - 43349327
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||||| || ||| |||  ||| ||||||| || |||||||||||||||| |||| ||| |||||||||||    
43349402 ggggaacaacgctttgccagtgttcatacctctactcacgagccggattagtcgctcacccttgatgggtcggaaa 43349327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 240
Target Start/End: Complemental strand, 10699009 - 10698936
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||| ||||||||| ||||||||||||||||| | |||  ||||||||| ||||||  |||||  |||||||||    
10699009 aacagcgtttggccagtgcgcatgcctctacgtacgagttggattagtcacccaccaatggtgaatcggaaacc 10698936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 241
Target Start/End: Original strand, 12754042 - 12754127
Alignment:
156 attcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||||| |||||||| || | || ||||||||||||||| |||  || | |||||||||| || ||||| ||| ||||||||||    
12754042 attcccagaggaacaacattagaccagtgcgcatgcctctatgcacaagtcagattagtcgctcatctttgatggatcggaaaccg 12754127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 25848219 - 25848276
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||| |||| ||||||||||||| |||| |||||| ||||||||| ||||||| ||||    
25848219 gtgcacatgtctctacgcatgagtcggactagtcgtccacctttgctgggtcgaaaac 25848276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 217
Target Start/End: Original strand, 28333050 - 28333115
Alignment:
152 ttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgc 217  Q
    ||||||||||| ||||| |||| ||| || ||||||||| ||||||| |||||| | |||||||||    
28333050 ttcgattcccaagggaataacgcttgaccagtgcgcatgtctctacgtatgagctgaattagtcgc 28333115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 197
Target Start/End: Original strand, 30903320 - 30903393
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctac 197  Q
    ||||| ||||||| ||||||||||||| |||||||  ||||| ||||| | ||| || ||||||||||| ||||    
30903320 tccaatgacgtattcggggaataccggattcgattttcagggaaacaatgcttgaccagtgcgcatgccgctac 30903393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 1653903 - 1653859
Alignment:
206 cggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||| |||   |||||||||||||||||||||||||||    
1653903 cggattagtcgtccattattggtgggtcggaaaccggtgcgaaag 1653859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 1742279 - 1742235
Alignment:
206 cggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||| |||   |||||||||||||||||||||||||||    
1742279 cggattagtcgtccattattggtgggtcggaaaccggtgcgaaag 1742235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 250
Target Start/End: Complemental strand, 9395894 - 9395818
Alignment:
174 tttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| ||||||| ||||||||||||||  |  || |||||||||| | | ||||||||||| |||||| ||||||||    
9395894 tttgacccgtgcacatgcctctacgcacaaatcgaattagtcgcctatcattggtgggtcgaaaaccgatgcgaaag 9395818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 21174167 - 21174215
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagt 214  Q
    |||||||| |||| | ||||||||| |||||||||| ||||||||||||    
21174167 gaacaacgcttggtcagtgcgcatggctctacgcatcagccggattagt 21174215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 35496322 - 35496278
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||||||||||| | |||| |||||| |||||||||||||    
35496322 gtgcgcatgcctctacgtacgagctggattaatcgcccacctttg 35496278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 94; Significance: 7e-46; HSPs: 93)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 42086308 - 42086437
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| |||||||||| ||||||||||||||| ||||||| ||| || ||||||||||||||||||||||||||||||||||| |||||    
42086308 tccaaggacgtacccgaggaataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 42086407  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||    
42086408 tttggtgggtcggaaaccggtgcgaaagcc 42086437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 41163585 - 41163457
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| |||| |||| |||||||||||||| |||||||||| ||||||    
41163585 tccaagaacgtacccggggaataccgggttcgattcccaggggaacaacgtttggccagtgcacatgtctctacgcatgagctggattagtcgtccacct 41163486  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || ||||||||||||| ||||||||||||    
41163485 tttgtgggtcggaaactggtgcgaaagcc 41163457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 38897842 - 38897716
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||  |||||||||||| ||||||| |||||||||||||| |||||| ||||||||||||||||||| ||||||||||||| ||||||||||    
38897842 caaggacgtatatggggaataccgggttcgatttccaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccaccttt 38897743  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||| ||||||||| |||||||||||    
38897742 ggtggatcggaaaccagtgcgaaagcc 38897716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 128 - 252
Target Start/End: Original strand, 1538416 - 1538541
Alignment:
128 aggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||| ||||||||||||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||| ||| ||||| |||    
1538416 aggacgtattcggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattg 1538515  T
227 gtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||    
1538516 gtgggtcggaaaccggtgcgaaagcc 1538541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 5732046 - 5731917
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||| ||||||||| |||||| ||||||||||||||||| ||||||| |||||||||  ||||    
5732046 tccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacc 5731947  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||||||||||||||||||||||    
5731946 tttagtgggtcggaaaccggtgcgaaagcc 5731917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 9812853 - 9812982
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||| ||| ||||||||| |||||| ||| |||||| ||||||||||| ||||||||||||||||||    
9812853 tccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacc 9812952  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
9812953 tttggtgggtcagaaaccggtgcgaaagcc 9812982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 142 - 252
Target Start/End: Original strand, 9805003 - 9805114
Alignment:
142 gaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    ||||||||| ||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||     
9805003 gaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaca 9805102  T
241 ggtgcgaaagcc 252  Q
    ||||||||||||    
9805103 ggtgcgaaagcc 9805114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 12704995 - 12705124
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||| ||| ||||||||| ||| || ||| |||||| ||||||||||| ||||||||||||||||||    
12704995 tccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacc 12705094  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
12705095 tttggtgggtcagaaaccggtgcgaaagcc 12705124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 19572705 - 19572834
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| || |||||||||||| ||||||  |||||| |||||||||||||||||||||||||||||||||||  ||||    
19572705 tccaaggacgtatccggggaataccgggttagattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacc 19572804  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||| ||||||| |||||||||||    
19572805 attggtgggttggaaaccagtgcgaaagcc 19572834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 8513500 - 8513628
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||| ||||||| ||| | |||||| |||| |||||||||||||| ||||| ||||||||| |||||    
8513500 tccaaggacgtacccggggaataccgggttcgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacc 8513599  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
8513600 tttggtgggtcggaaaccggtgcgaaagc 8513628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 130 - 251
Target Start/End: Original strand, 23383644 - 23383766
Alignment:
130 gacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||||| | |||||||||| ||||||||||||||| ||||||| |||||| |||||| ||||||||||||||||| |||||||||| |||||||||||    
23383644 gacgtatcagaggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggt 23383743  T
229 gggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| |||||||||||    
23383744 gggtcggaaactggtgcgaaagc 23383766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 12766112 - 12766241
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||  ||| ||||||| | |||||| ||| |||||||||||||||||| || |||||||||||||||    
12766112 tccaaggacgtacccggggaataccgggttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacc 12766211  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
12766212 tttggtgggtcagaaaccggtgcgaaagcc 12766241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 126 - 249
Target Start/End: Original strand, 20525821 - 20525945
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||| |||||||||||||| ||| ||||||||||||| ||||||||  || ||| ||||||||||||||||||||||||||||||||||| ||||| |    
20525821 caaggatgtatccggggaatatcgggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccat 20525920  T
225 tggtgggtcggaaaccggtgcgaaa 249  Q
    |||||| ||||||||||||||||||    
20525921 tggtggatcggaaaccggtgcgaaa 20525945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 249
Target Start/End: Original strand, 37263225 - 37263347
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||| |||||||||| ||| |||||||| ||||||||||||| ||||||  |||||||||||||||||| ||||||||||||||| ||||||||     
37263225 aaggacgtacccggggaatatcgggttcgattctcaggggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccaccttta 37263324  T
227 gtgggtcggaaaccggtgcgaaa 249  Q
     ||| ||||||||||||||||||    
37263325 ttggatcggaaaccggtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 42861344 - 42861215
Alignment:
124 tccaaggacgtatccggggaataccggtttcgatt-cccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| ||||||||||||| ||| ||| ||| ||||||| ||||||  |||||| ||||||||||||||||||||||||||||||| ||| |||||    
42861344 tccaaggacatatccggggaatatcgggttcaatttcccagggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccacc 42861245  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||||||| |||||||||||||||    
42861244 attggtgggtcggagaccggtgcgaaagcc 42861215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 7866562 - 7866690
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| |||||||||| ||||||||| ||| ||||||||| |||||| ||| ||||||||||||||| || ||||||||||||||||||    
7866562 tccaaggacgtacccgaggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacc 7866661  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||  |||||| ||||||||||    
7866662 tttggtgggttagaaaccagtgcgaaagc 7866690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 9168378 - 9168251
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||| ||||||||||||||||||||    |||||||||| ||||||||| |||||| |||||||| |||||||||||||||||||||||||| ||||||    
9168378 tccaaagacgtatccggggaataccgagaacgattcccagaggaacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacct 9168279  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    || |||||||| ||| |||||| |||||    
9168278 ttagtgggtcgaaaatcggtgcaaaagc 9168251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 2485178 - 2485304
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||| | |||||||| || ||||||||| |||||||||||  | |||| ||||||||||||||||| ||||| |||||||||||| |||||    
2485178 tccaaggacgtattcagggaatactgggttcgattcctaggggaacaaccctgggcctgtgcgcatgcctctacgtatgagtcggattagtcgctcacct 2485277  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| |||||||||||||| ||||||||    
2485278 ttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 251
Target Start/End: Original strand, 12081892 - 12082017
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||||||||||||| || |||||||| |||||| ||||||| |||||| |||||||||| |||||||| |||||| |||||||| ||||||||    
12081892 aaggacgtatccggggaatactgggttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccaccttt 12081991  T
226 ggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||| ||||| ||||||    
12081992 ggtgagtcggaaatcggtgtgaaagc 12082017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 13664241 - 13664370
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||  ||||||||||| |||||||  |||||| ||||||  |||||| ||||||||||||||||||||||||| ||||| |||  ||||    
13664241 tccaaggacgtatctagggaataccggattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacc 13664340  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| ||||||||||||||||||||||    
13664341 tttggtgtgtcggaaaccggtgcgaaagcc 13664370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 30349560 - 30349689
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| || |||| | ||||| ||||| | |||||| ||||||||||||||| |||||||| | |||||||| |||||    
30349560 tccaaggacgtatccggggaataccgggtttgatttctagggggaacaatgattggccagtgcgcatgcctctatgcatgagctgaattagtcgtccacc 30349659  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || |||||| ||||||||||||||||||||    
30349660 ttaggtgggccggaaaccggtgcgaaagcc 30349689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 163 - 252
Target Start/End: Complemental strand, 39099865 - 39099776
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||  |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
39099865 ggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagcc 39099776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 130 - 249
Target Start/End: Complemental strand, 42291625 - 42291505
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||| |||| ||||||||| || ||||||||||| |||||||| |||||| |||| |||||||||||||| ||||||||||||||| ||||||||| |    
42291625 gacgtacccggagaataccgggtttgattcccagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgat 42291526  T
229 gggtcggaaaccggtgcgaaa 249  Q
    || ||||||||||||||||||    
42291525 ggatcggaaaccggtgcgaaa 42291505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 25417309 - 25417182
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  ||||||||||||| ||||||||||||||| ||||||| |||||| ||||||||||||||||| | ||||||||||||||    |||    
25417309 tccaaggacgtactcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttacc 25417210  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     |||||||||| ||||||||||||||||    
25417209 attggtgggtcagaaaccggtgcgaaag 25417182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 130 - 251
Target Start/End: Original strand, 40117402 - 40117524
Alignment:
130 gacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    ||||||| ||||||||| ||  ||||||| ||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |||  ||||||||||    
40117402 gacgtattcggggaatatcgaattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggt 40117501  T
229 gggtcggaaaccggtgcgaaagc 251  Q
    || ||| ||||||||||||||||    
40117502 ggatcgaaaaccggtgcgaaagc 40117524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 126 - 250
Target Start/End: Complemental strand, 14588741 - 14588616
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||| |||||||| ||| |||||||  |||| |||| |||| ||| || ||||||||||||||||||||||||||||||||||| |||||||    
14588741 caaggacgtatctggggaatatcgggttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctt 14588642  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    ||||| | || |||||||||||||||    
14588641 tggtgagccgaaaaccggtgcgaaag 14588616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 127 - 251
Target Start/End: Complemental strand, 20682740 - 20682615
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||| ||||||||||  || || |||| ||||||| ||||||| |||||| ||||||||||||||||||| ||||||||||| ||| ||||||||    
20682740 aaggacgtacccggggaatattgggttagatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccaccttt 20682641  T
226 ggtgggtcggaaaccggtgcgaaagc 251  Q
     |||||| ||||||||||||||||||    
20682640 agtgggttggaaaccggtgcgaaagc 20682615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 3654038 - 3653911
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||| ||||||||| ||||||||| || | ||||||| ||| || ||||||||||||||||||| ||| ||||||||||| ||||||    
3654038 tccaaggacgtacccggagaataccgggttcgattcctagag-aacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacct 3653940  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| ||| |||||||||| ||||||    
3653939 ttggtggatcgaaaaccggtgcaaaagcc 3653911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 11845927 - 11845800
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| | |||| ||| ||||||| | ||||| |||||||||||||| ||||||||||||||||| |||||||| |||| |||||||||    
11845927 tccaaggacgtacccgagaaatatcgggttcgatttcgagggggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgcccacc 11845828  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| ||||| ||||||||||| |||||    
11845827 tttgatgggttggaaaccggtgtgaaag 11845800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 14728104 - 14728192
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||| |||| | ||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||    
14728104 gggggacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc 14728192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 230
Target Start/End: Complemental strand, 14974447 - 14974343
Alignment:
127 aaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||| ||||| ||| ||||||||  | |||||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||||    
14974447 aaggacgtatccggagaatatcgggttcgattctaaaggggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtcgtccaccttt 14974348  T
226 ggtgg 230  Q
    |||||    
14974347 ggtgg 14974343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 18136406 - 18136273
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggatta----gtcgcc 218  Q
    ||||| ||||||||||| ||||||||| ||||||||||||||| ||||||  |||| | ||| |||||||||||| ||||||||||||||    |||| |    
18136406 tccaaagacgtatccggagaataccgggttcgattcccagggggaacaacacttggtcagtgtgcatgcctctacacatgagccggattaattagtcgtc 18136307  T
219 cacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |||||||||||||||||||||| ||||||    
18136306 caccattggtgggtcggaaaccggtgcaaaagcc 18136273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 5079312 - 5079440
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||||||| ||||||||||  | |||| ||||||| |||| || |||| |  ||||||||| |||||||| |||||||||||||||||||||    
5079312 tccaagcacgtatccgtggaataccggggttgatttccagggggaacagcgcttggtcaatgcgcatgcttctacgcacgagccggattagtcgcccacc 5079411  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| ||||| |||||||||||||||||    
5079412 tttggt-ggtcgaaaaccggtgcgaaagcc 5079440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 28857194 - 28857255
Alignment:
190 gcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
28857194 gcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 38369695 - 38369808
Alignment:
138 cggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    ||||||||| ||| |||||||| ||||||||||||  |||||| ||||||||||||||||||| ||| |||||||||  |||||||||| |||||  |||    
38369695 cggggaatatcgggttcgattctcaggggaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttagaa 38369794  T
238 accggtgcgaaagc 251  Q
    | ||||||||||||    
38369795 atcggtgcgaaagc 38369808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 243
Target Start/End: Complemental strand, 7308490 - 7308370
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||  | |||||| ||| ||||||||||||||| ||||||| |||| | |||| ||||||||||||||||||||||||||||||| ||||    
7308490 tccaaggacgtatttgaggaatatcgggttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacc 7308391  T
223 tttggtgggtcggaaaccggt 243  Q
    |||| ||| ||  ||||||||    
7308390 tttgatggatcaaaaaccggt 7308370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 43399149 - 43399237
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| |||| |||||| ||||||||||||||||||| |||| |||||||||| |||| |||||| ||||||||||||||||||||||    
43399149 ggggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc 43399237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 20692914 - 20693041
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| || |||||| || |||| ||||| |||||| || | |||||||||  ||||||  | ||||||| | |||||    
20692914 tccaaggacgtacccggggaataccgggtttgattcctagaggaaacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacc 20693013  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||||||||||    
20693014 tttggtgggtcggaaaccggtgcgaaag 20693041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 163 - 252
Target Start/End: Complemental strand, 4016341 - 4016252
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||  |||||| |||||||||||||||| || ||||||||||||| || |||| ||||||||||||||||| |||||||||||    
4016341 ggggaacaacacttggccagtgcgcatgcctctacacacgagccggattagttgctcaccattggtgggtcggaaaccagtgcgaaagcc 4016252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 20255409 - 20255478
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||| |||||||||||    
20255409 gtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc 20255478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 143 - 252
Target Start/End: Original strand, 21375352 - 21375461
Alignment:
143 aataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgg 242  Q
    |||| ||| ||||| ||||| ||||||||| |||| || |||||||||| |||||||||||| ||||||||||| ||| ||||| ||| ||||||||| |    
21375352 aatatcgggttcgactcccaagggaacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccag 21375451  T
243 tgcgaaagcc 252  Q
    ||||||||||    
21375452 tgcgaaagcc 21375461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 23247477 - 23247349
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||| ||| ||||||||||||| ||||||||| |||  | ||  ||||||||||||||| ||||| ||||||||| |||||    
23247477 tccaaggacgtacctggggaatatcgggttcgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacc 23247378  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| | ||||| |||||||||||||||||    
23247377 tttgat-ggtcgaaaaccggtgcgaaagcc 23247349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 124 - 208
Target Start/End: Original strand, 28857109 - 28857194
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccgg 208  Q
    |||||||||| | |||||||||||||| ||||||||||||||| ||||||  |||||| |||||||||||||||||||||||||||    
28857109 tccaaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 28857194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 18294609 - 18294493
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||| ||  ||| ||||||||| ||| ||  |||||||||||||| |||| | |||||||| ||||||| ||||| |||||||| ||||||| ||    
18294609 tccaaggacatactcggagaataccgggttcaatatccaggggaacaacgcttggtcagtgcgcatacctctacacatgaaccggattaatcgcccatct 18294510  T
224 ttggtgggtcggaaacc 240  Q
    |||||||||||||||||    
18294509 ttggtgggtcggaaacc 18294493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 166 - 250
Target Start/End: Complemental strand, 24463969 - 24463885
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||||||||  ||||||| |||||||||| ||||    
24463969 gaacaacgattggccagtgcgcatgcctctatgcacgagccggattagtcgcccacctttactgggtcgaaaaccggtgcaaaag 24463885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 28857002 - 28857058
Alignment:
195 tacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
28857002 tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 30995102 - 30995209
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||   |||||||||| | ||||||||||||||| ||||||  |||||| | ||||||||||||||||| |||||||||||||||| || |    
30995102 tccaaggacgtacatggggaataccaggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccggattagtcgctcatc 30995201  T
223 tttggtgg 230  Q
    ||||||||    
30995202 tttggtgg 30995209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 130 - 252
Target Start/End: Original strand, 41800964 - 41801087
Alignment:
130 gacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||||| |||||||| ||| |||||||| || ||||||||||| ||| ||  |||||||| ||||||||| |||||||||||||||  || ||||| |    
41800964 gacgtatctggggaatatcgggttcgattctcaaggggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgat 41801063  T
229 gggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| ||||| |||||||    
41801064 gggtcggaaagcggtgtgaaagcc 41801087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 1898982 - 1899105
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| |||||||||||||| ||||||||||| ||||||||||| |||||| |||||||||      |||| |||||| ||||||| ||||||    
1898982 tccaaggatgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatg------cgcacgagccgaattagtcacccacc 1899075  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||  ||||||||||| ||||||    
1899076 ttttgtgggttagaaaccggtgcaaaagcc 1899105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 24653935 - 24653810
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||||||||||||  || |||||||  ||||| |||||||  |||| | |||||||| ||||||||||| |||||||||| ||| ||||| |    
24653935 caaggacgtatccggggaatatagggttcgattttcagggagaacaacacttggtcagtgcgcatacctctacgcat-agccggattaatcgtccaccat 24653837  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||| |||||| |||||||||    
24653836 tggtgggtcgaaaaccgatgcgaaagc 24653810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 18045622 - 18045746
Alignment:
126 caaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||| |||||||||||||||| || ||||||||||| ||||||||||  ||||   || ||||||||||||| |||||||| ||||| ||| |||||||    
18045622 caagggcgtatccggggaatactgggttcgattcccagggggaacaacccttggttggtacgcatgcctctacacatgagcc-gattaatcgtccacctt 18045720  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    | |||| |||||||||| ||||||||    
18045721 tagtggatcggaaaccgatgcgaaag 18045746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 18262731 - 18262615
Alignment:
137 ccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg 235  Q
    |||||||||||||| ||| |||  |||||| ||||||| ||| || |||||||| ||||||| || |||||||||||||||||||||| || ||| |||     
18262731 ccggggaataccgggttctattttcagggggaacaacgcttgaccagtgcgcatacctctacacacgagccggattagtcgcccacctctgatggatcga 18262632  T
236 aaaccggtgcgaaagcc 252  Q
    ||| |||||||||||||    
18262631 aaatcggtgcgaaagcc 18262615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 15034056 - 15034174
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| |||||||||||||| ||| ||| ||| ||||| ||||  |||| | ||| ||||||||||||||||||||| ||||||| | |||||    
15034056 tccaaggatgtacccggggaataccgggttcaatttccatgggaaacaacacttggtcagtgtgcatgcctctacgcatgagcctgattagttgtccacc 15034155  T
223 tttggtgggtcggaaaccg 241  Q
    |||| ||| ||||||||||    
15034156 tttgatggatcggaaaccg 15034174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 165 - 249
Target Start/End: Original strand, 21487640 - 21487721
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||  ||||||||||||||   || ||||||||||||||||||||||||  ||||||| ||||||||||||||    
21487640 ggaacaacgtttggctagtgcgcatgcctct---cacgagccggattagtcgcccacctttaatgggtcgaaaaccggtgcgaaa 21487721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 167 - 244
Target Start/End: Complemental strand, 6764539 - 6764462
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtg 244  Q
    ||||| |||||||  ||||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||| ||||    
6764539 aacaatgtttggctagtgcgcatgcctctacgcacgagccggattagtcgcctatctttgttgggtcggaaactggtg 6764462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 20590020 - 20590109
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| |||||| ||||||||| |||||||||||||||| |||||| | ||||  |||| || ||||||||||||||| |||||    
20590020 ggggaacaacgcttggccagtgcgcatgactctacgcatgagccgtattagttgtccactattggaggatcggaaaccggtgcggaagcc 20590109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 21149717 - 21149842
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||  | |||||||| | |||||||  |||||| ||||||||||| || ||||||||| ||||||||| |||  |||||||||||||||| |    
21149717 caaggacgtatttgaggaataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccat 21149816  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    |||||| | | |||||| ||||||||    
21149817 tggtggatagaaaaccgatgcgaaag 21149842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 166 - 238
Target Start/End: Original strand, 24875369 - 24875441
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||||||| || ||||||||| ||||||||| ||||||||||| ||| ||||||||| |||||||||||    
24875369 gaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa 24875441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 250
Target Start/End: Complemental strand, 27648488 - 27648424
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||| ||||||||||||||||| ||| ||||||||| |||||||||| ||||||||    
27648488 gcatgcctctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaaag 27648424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 124 - 243
Target Start/End: Complemental strand, 35813124 - 35813004
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaac-aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| |||||||||| ||||||||| |||||||  || | ||| || ||||||||| |||||| |||||| ||||||||||| |||||    
35813124 tccaaggacgtacccgaggaataccgggttcgattcctaggggaaataatgcttgaccagtgcgcatgtctctacacatgagtcggattagtcgtccacc 35813025  T
223 tttggtgggtcggaaaccggt 243  Q
    ||||  | |||| ||||||||    
35813024 tttgaagtgtcgaaaaccggt 35813004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 161 - 252
Target Start/End: Original strand, 25452944 - 25453034
Alignment:
161 caggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||| || ||| ||||||||||||||| ||||||||||||||| ||| |||| || ||||| |||||||||| ||||||    
25452944 caggggaacaatgtttgaccagtgtgcatgcctctacgcacgagccggattagtcg-ccaactttagtcggtcgaaaaccggtgcaaaagcc 25453034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 226
Target Start/End: Original strand, 26077122 - 26077225
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||  |||||||||  | |||||||||||| |||||||||| |||||| |||| |||||||||||||| ||||| ||||| |||| || |    
26077122 tccaaggacgtatttggggaatactaggttcgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagccagattaatcgctcatc 26077221  T
223 tttg 226  Q
    ||||    
26077222 tttg 26077225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 238
Target Start/End: Complemental strand, 35561944 - 35561829
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||||||||||||| ||  ||||| | |||| |||||||||   || || |||||||||||||||| |||||||| |||||||||| ||||    
35561944 tccaatgacgtatccggggaatatcgagttcgacttccagagggaacaacacctgaccagtgcgcatgcctctacacatgagccagattagtcgctcacc 35561845  T
223 tttggtgggtcggaaa 238  Q
     ||||| |||||||||    
35561844 gttggtaggtcggaaa 35561829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 35245091 - 35245017
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||||||||| || ||| |||||| |||||||||||||| ||||||| ||||||||||| ||| |||||||    
35245091 gggaacaacgtttgaccagtgtgcatgcttctacgcatgagcctgattagttgcccacctttgatggttcggaaa 35245017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 251
Target Start/End: Original strand, 7616940 - 7617029
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||| || ||  ||||||||||||||||||| | ||||||||| |||   ||||||| |||||||| |||||||||||    
7616940 aggggaacaacgtttgaccagtatgcatgcctctacgcatgagtcagattagtcgtccattattggtggatcggaaactggtgcgaaagc 7617029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 17693459 - 17693337
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg-cccac 221  Q
    ||||||||||||  |||||| |||||| ||| ||||||||| ||||||||| ||        |||||||||||||||||||||| ||||||||| ||  |    
17693459 tccaaggacgtactcggggagtaccgggttcaattcccaggaggaacaacgctt--------cgcatgcctctacgcatgagccagattagtcgtccgtc 17693368  T
222 ctttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||| |||||||||||||||||||    
17693367 ttttggtgggttggaaaccggtgcgaaagcc 17693337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 152 - 252
Target Start/End: Complemental strand, 22655255 - 22655155
Alignment:
152 ttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||| ||| |||||  | ||| |||||||||||||||| || | ||||||||| |||||||| |||||||| ||||| |||||||||    
22655255 ttcgattcccaggggaaacaatgtttgatcagtgtgcatgcctctacgcataagtcagattagtcgtccaccttt-gtgggtcgaaaaccagtgcgaaag 22655157  T
251 cc 252  Q
    ||    
22655156 cc 22655155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 248
Target Start/End: Original strand, 28862806 - 28862931
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||| ||||||||| | | |||||||| |||| ||||||||| ||||||  ||| |||||||||||||| || | | |||||| || ||||    
28862806 tccaaagacgtattcggggaatatcaggttcgattctcaggcggaacaacgcttggccaatgcacatgcctctacgcacgacctgaattagttgctcacc 28862905  T
223 tttggtgggtcggaaaccggtgcgaa 248  Q
     || || |||||||||||||||||||    
28862906 attagtaggtcggaaaccggtgcgaa 28862931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 195 - 252
Target Start/End: Original strand, 36783296 - 36783353
Alignment:
195 tacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||| ||||| ||||||||| |||||||||||| ||||||    
36783296 tacgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcaaaagcc 36783353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 39728368 - 39728497
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| |||||||||||| | |||||||  ||| |||| ||||  |||||| ||| ||||||||||||||  ||| || ||||||||| ||||    
39728368 tccaagaacgtacccggggaataccaggttcgattatcagaggaaacaacacttggccagtgtgcatgcctctacgctcgagtcgaattagtcgctcacc 39728467  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |  ||||||||||||||| ||||||    
39728468 tttgatacgtcggaaaccggtgcaaaagcc 39728497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 251
Target Start/End: Original strand, 7336604 - 7336728
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||||| |||||| ||| ||||||| | | || |||||||| ||   | ||||||||||||||||||| ||||||||||| ||| | ||||||    
7336604 aaggacgtatccgaggaatatcgggttcgatttctaaggagaacaacgctttatcagtgcgcatgcctctacgcacgagccggattaatcgtctaccttt 7336703  T
226 ggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| |   ||||||||||||||||    
7336704 ggtggat-aaaaaccggtgcgaaagc 7336728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 14152046 - 14152159
Alignment:
139 ggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    |||||||||||| |||||||| ||  |||||||||| |||||| ||| |||||| ||||  |||||||||||||| ||| ||||| ||| ||| ||| ||    
14152046 ggggaataccgggttcgattctcatagggaacaacgcttggccagtgtgcatgcttctatccatgagccggattaatcgtccaccattgatggatcgaaa 14152145  T
238 accggtgcgaaagc 251  Q
    |||  |||||||||    
14152146 acctatgcgaaagc 14152159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 14235777 - 14235712
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||||| ||||||| |||||||||| ||||||||||||||||| ||||||| ||| |||||    
14235777 gcatgactctaagcatgagtcggattagtcacccacctttggtgggtcagaaaccgatgcaaaagc 14235712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 18327793 - 18327870
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| ||| |||||||||| |||||||||| ||| ||||||| | |||| ||||||||||||||| ||| ||||||    
18327793 ttggccagtgtgcatgcctctgcgcatgagccagatcagtcgccaatctttagtgggtcggaaaccgatgcaaaagcc 18327870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 197 - 250
Target Start/End: Complemental strand, 25950646 - 25950593
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||||| ||||||||||||||||| ||| || ||||||||    
25950646 cgcatgagccggattagtcgtccacctttggtgggtcgaaaatcgatgcgaaag 25950593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 13887510 - 13887562
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||| ||||||||||||||||||||||||  |||||||||| |||||||||||    
13887510 cgcacgagccggattagtcgcccacctttaatgggtcggaacccggtgcgaaa 13887562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 175 - 251
Target Start/End: Original strand, 22295249 - 22295325
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| |||||||||||||||||||||||  |||||||||||  | ||||||| |||| |||| || |||||||||    
22295249 ttggccagtgcgcatgcctctacgcatgagttggattagtcgcttatctttggtaggtcagaaatcgatgcgaaagc 22295325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 24498964 - 24499092
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||| || ||||| ||| ||||||| | | |  || |||| |||  | ||||||||||||||||| | ||||||||||| | | ||| ||    
24498964 tccaaggacgtatctggagaatatcgggttcgatttctaagaaaataacgcttgatcagtgcgcatgcctctacgtacgagccggattaatagtccatct 24499063  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| |||||  ||||||||||||    
24499064 ttggtgggttggaaattggtgcgaaagcc 24499092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 184 - 252
Target Start/End: Original strand, 40773315 - 40773383
Alignment:
184 gcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||  | ||| |||||||||||  || |||||||| ||||||||||||||||||||||    
40773315 gcgcatgcctctacatacgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaagcc 40773383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 38296783 - 38296728
Alignment:
196 acgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||| ||||||||||||||||||||| |||||||||||||| ||| |||||    
38296783 acgcacgagtcggattagtcgcccacctttgatgggtcggaaaccgatgcaaaagc 38296728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 27484205 - 27484270
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||| ||||||||| || ||| ||||| | ||| ||||||||||| ||||||    
27484205 gcatgcctctacgcatgaaccggattagacgtccatctttgataggttggaaaccggtgtgaaagc 27484270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 239
Target Start/End: Original strand, 32874807 - 32874884
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||||||||||| ||| |  |||||||| ||| |||||| |||||| |||| ||| ||||| ||||||||||||||||    
32874807 aggggaacaacgcttgactagtgcgcatacctttacgcacgagccgaattaatcgtccaccattggtgggtcggaaac 32874884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 40060339 - 40060391
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||| ||| ||||| ||| ||||| ||||||||||||||||    
40060339 cgcatgagccggattaatcgtccaccattgatgggttggaaaccggtgcgaaa 40060391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 6767177 - 6767130
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaa 171  Q
    |||||||||||| |||||||||||||| ||||||||  ||||||||||    
6767177 tccaaggacgtacccggggaataccgggttcgattcataggggaacaa 6767130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 252
Target Start/End: Original strand, 16757405 - 16757488
Alignment:
169 caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||   |||||||||||||||||||| ||  | |||| ||| ||| |||| ||||||| ||||||| ||||||||||    
16757405 caacgtttggttagtgcgcatgcctctacgcataagttgaattaatcgtccatctttagtgggtcagaaaccgatgcgaaagcc 16757488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 28856958 - 28857000
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg 166  Q
    |||||||||| | |||||||||||||| |||||||||||||||    
28856958 tccaaggacgcacccggggaataccgggttcgattcccagggg 28857000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 215
Target Start/End: Complemental strand, 35006843 - 35006769
Alignment:
142 gaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtc 215  Q
    ||||||||| ||| ||||| || |||||||||| |||| | ||| ||||||||||||||| ||||| ||||||||    
35006843 gaataccgggttccattccgagagggaacaacgcttggtcagtgtgcatgcctctacgcacgagccagattagtc 35006769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 250
Target Start/End: Complemental strand, 43212590 - 43212504
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||  | ||||||||||| | ||||||  ||||||||||  |||| || ||||||| ||||||| | ||||||    
43212590 gggaacaacgtttggccaatacgcatgcctctgcacatgagttggattagtcgttcaccatttgtgggtcagaaaccgatacgaaag 43212504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 250
Target Start/End: Original strand, 16755104 - 16755157
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||||||||| ||||  |||||||||  ||||||||||||||||    
16755104 cgcatgagtcggattagtcgtccactattggtgggttagaaaccggtgcgaaag 16755157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 20228757 - 20228826
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| |||||||||| || ||| | ||||||||||||| ||||||||| || ||||||| || ||||||    
20228757 gtgcgtatgcctctacacacgagtcagattagtcgcccatctttggtggatcagaaaccgatgtgaaagc 20228826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 200
Target Start/End: Complemental strand, 35403638 - 35403561
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgca 200  Q
    ||||||||||||  |||| |||||||| ||||||||  ||||| ||||||| ||||||  |||||||| |||||||||    
35403638 tccaaggacgtactcgggaaataccgggttcgattctaagggggaacaacgcttggccaatgcgcatgtctctacgca 35403561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 249
Target Start/End: Original strand, 19839350 - 19839434
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||| |||  | ||||||||||||||||  | ||| | ||||||||||| |||||| ||| |||||||| || |||||||    
19839350 ggaacaacgcttgatcagtgcgcatgcctctacatacgagtcagattagtcgcctacctttagtgagtcggaaatcgatgcgaaa 19839434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 200
Target Start/End: Complemental strand, 38297073 - 38297013
Alignment:
141 ggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgca 200  Q
    |||||||||| ||| ||||||| |||||||||||||||| | |||||||| | ||||||||    
38297073 ggaataccgggttcaattcccaaggggaacaacgtttggtcagtgcgcattcttctacgca 38297013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 93)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 7747254 - 7747383
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||  ||||    
7747254 tccaaggacgtatccggggaataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacc 7747353  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||||||||||||||||||||||    
7747354 tttagtgggtcggaaaccggtgcgaaagcc 7747383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 10823040 - 10823169
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| || |||||||||| ||||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||    
10823040 tccaaggacgtacccggggaataccgggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacc 10823139  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||||||||||||||||||||||    
10823140 ttttgtgggtcggaaaccggtgcgaaagcc 10823169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 38005382 - 38005511
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||||||||| || ||||||||||| ||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||    
38005382 tccaaggacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacc 38005481  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||||| ||||||||||||    
38005482 tttggtggatcggaaactggtgcgaaagcc 38005511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 41220615 - 41220744
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| ||||||||  ||||    
41220615 tccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacc 41220714  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||||||||||||||||||||||||||    
41220715 tttagtgggtcggaaaccggtgcgaaagcc 41220744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 25540530 - 25540402
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| ||||||||| || ||||||||| ||||| ||||||| |||||| ||||||||||||||||||| ||||||||||||||| |||||    
25540530 tccaaggacgtatctggggaatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacc 25540431  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
25540430 tttggtgggtcggaaaccggtgcgaaagc 25540402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 240
Target Start/End: Original strand, 331481 - 331598
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||||| ||||||  |||||| |||||||||| ||||||||||||||||||||||||||||||    
331481 tccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacc 331580  T
223 tttggtgggtcggaaacc 240  Q
    |||||||||| |||||||    
331581 tttggtgggttggaaacc 331598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 8410111 - 8410240
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||| ||||| ||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||| ||||||||||||||||||||     
8410111 tccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccact 8410210  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||| ||||||||||||||||||||||||    
8410211 tttggggggtcggaaaccggtgcgaaagcc 8410240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 22593115 - 22593242
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||||||||| |  ||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||    
22593115 tccaaggacgtacccggggaatactgagttcgattcccagggggaacaacgtt-ggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 22593213  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||| ||||||||||||||||    
22593214 tttggtgggtcgg-aaccggtgcgaaagcc 22593242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 38962745 - 38962870
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||||||| |||||||  |||| ||||||||| |||||| |||||||||||||||||||||| |||||||||||| |||||||    
38962745 caaggacgtatccggggaataccgggttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctt 38962844  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||| ||||| ||||||||||    
38962845 tggtgggtcagaaactggtgcgaaag 38962870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 18902656 - 18902528
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  ||||||||||||| ||||||||||| ||||||||||| ||| || |||||| || ||||||||| ||||| |||||||||||||||    
18902656 tccaaggacgtactcggggaataccgggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacc 18902557  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
18902556 tttggtgggtcggaaaccggtgcgaaagc 18902528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 44139464 - 44139592
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| | ||| |||||||||||| ||||||||||||||| ||||||| |||||| |||||| |||||||||||| |||||||||||||||||||||    
44139464 tccaaggatgcatctggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccacc 44139563  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
      |||||||||||||||||||||||||||    
44139564 aatggtgggtcggaaaccggtgcgaaagc 44139592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 35946722 - 35946845
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||||||||||||||||||||  ||||||||| |||||||||||| ||||||  || ||||||||||||||| ||||||||||||||| ||||| |||    
35946722 aaggacgtatccggggaataccgagttcgattcctaggggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattg 35946821  T
227 gtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||| ||||||||||    
35946822 gtgggtcggaaactggtgcgaaag 35946845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 2550850 - 2550975
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||| ||| ||||||||||||| ||||||||  || ||| ||||||||| |||||||||||||||||||||||||||||| ||    
2550850 caaggacgtatccggggaatatcgggttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttt 2550949  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| | |||||||||||||||    
2550950 tggtgggttgaaaaccggtgcgaaag 2550975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 3644013 - 3643885
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| || |||| | | | ||||||||| |||||| |||||||||||||||||||||||| |||||||||| |||||    
3644013 tccaaggacgtatccggggaataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacc 3643914  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| ||||||||| |||||||||    
3643913 tttggtgggccggaaaccgttgcgaaagc 3643885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 6358274 - 6358150
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||||||||||| | ||||||| ||||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||| ||||| ||    
6358274 aaggacgtatccggggaataccagattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccatt 6358175  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||| ||||||||| |||||    
6358174 ggtgggtcgaaaaccggtgtgaaag 6358150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 239
Target Start/End: Complemental strand, 10026742 - 10026626
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  |||  |||||||| |||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||    
10026742 tccaaggacgtactcggaaaataccgggttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacc 10026643  T
223 tttggtgggtcggaaac 239  Q
    |||||||||||||||||    
10026642 tttggtgggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 12455303 - 12455419
Alignment:
137 ccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg 235  Q
    |||||||||||||| ||||||| ||||||||| ||||| || ||| ||||||||||||||||||| |||||||||||||||| |||| ||||||||||||    
12455303 ccggggaataccgggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcgg 12455402  T
236 aaaccggtgcgaaagcc 252  Q
    |||||||||||||||||    
12455403 aaaccggtgcgaaagcc 12455419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 9360874 - 9360747
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||| | ||||||| | || |||| |||||||||||| ||||||||||||||||||| |||||| ||||||||||||||    
9360874 tccaaggacgtacccggggaataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacc 9360775  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| ||||| ||||||||||||||||||    
9360774 tttagtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 11069858 - 11069986
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||| | ||||||||| ||||| |||||||||||||| |||||||| |||||||||| |||| | |||||||| |||||    
11069858 tccaaggacgtacccggggaataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaattagtcgtccacc 11069957  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     |||||||||||||||||| |||||||||    
11069958 gttggtgggtcggaaaccgatgcgaaagc 11069986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 41032031 - 41031904
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| || ||||| ||||| ||||||||||||||| ||||||  |||||| ||| ||||||||||||||| |||||||||||||| ||||||    
41032031 tccaaggacgta-ccagggaacaccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccacc 41031933  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||| ||||||||||    
41031932 tttggtgggtcggaaaccagtgcgaaagc 41031904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 44945574 - 44945702
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||  ||| |||||| || || ||||||||| ||||||||| ||||   ||||||||||||||||||| ||||||||||||||||||||||    
44945574 tccaaggacgtactcggagaatactgggtttgattcccagaggaacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacct 44945673  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || |||| |||||||||||||||||||||    
44945674 ttagtggatcggaaaccggtgcgaaagcc 44945702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 12864204 - 12864331
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||| ||||||||||||| ||||||| ||||||| ||||||  |||| | |||||||||||||| |||||||||| ||||||||| |||||    
12864204 tccaatgacgtattcggggaataccggattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccacc 12864303  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     |||||||||||||||||||||||||||    
12864304 attggtgggtcggaaaccggtgcgaaag 12864331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 14169735 - 14169608
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattc-ccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||| ||| |||||||| || ||||||||||  ||| || ||||||||| ||||||||||||||||||||||||| | |||    
14169735 tccaaggacgtattcggggaatatcgggttcgattctccgggggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctacc 14169636  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     |||||||||||||||||||||||||||    
14169635 attggtgggtcggaaaccggtgcgaaag 14169608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 3811817 - 3811688
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  || |||||| ||| |||||||||||| |||||||||  |||| |  |||||||||||||||||||||||||||||| |||||||||    
3811817 tccaaggacgtactcgaggaatatcgggttcgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacc 3811718  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||| ||||||||||    
3811717 tttggtgggtcagaaaccgatgcgaaagcc 3811688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 37560153 - 37560282
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| |||||||| | |||||||| || |||||||||||||||| | ||||||||||||||||||| ||||||||||| ||| |||||    
37560153 tccaaggacgtacccgaggaataccaggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacc 37560252  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||||||| ||||||||| |||||||    
37560253 tttgatgggtcgaaaaccggtgtgaaagcc 37560282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 244
Target Start/End: Complemental strand, 39201634 - 39201513
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  || |||||||||  |||||||| |||||| ||||| |||||||| ||| |||||||||||||||||||||||||||||||  ||||    
39201634 tccaaggacgtactcgaggaataccgaattcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacc 39201535  T
223 tttggtgggtcggaaaccggtg 244  Q
    ||||||||||||||||||||||    
39201534 tttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 239
Target Start/End: Complemental strand, 10046602 - 10046487
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| |||||||||| ||||||||| |||||||| || ||||| ||||||||| |  ||||||||||||||||||||||||||||||||||| |||||    
10046602 tccaagaacgtatccggagaataccgggttcgattctcaagggaaacaacgtttgaca-gtgcgcatgcctctacgcatgagccggattagtcgaccacc 10046504  T
223 tttggtgggtcggaaac 239  Q
    |||||||||||||||||    
10046503 tttggtgggtcggaaac 10046487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 21286424 - 21286551
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||| || ||||||||||||||||||| |||| ||||||||| | || |    
21286424 tccaaggacgtatccggggaataccgggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattagtcactcatc 21286523  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||||||||| |||||||||||| ||||    
21286524 attggtgggttggaaaccggtgcaaaag 21286551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 142 - 252
Target Start/End: Original strand, 24179568 - 24179677
Alignment:
142 gaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    ||||||||||| |||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||| |||||||||||   ||||||    
24179568 gaataccggtt-cgattctcaggggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtgggttaaaaaccg 24179666  T
242 gtgcgaaagcc 252  Q
    |||| ||||||    
24179667 gtgcaaaagcc 24179677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 128 - 250
Target Start/End: Original strand, 33005736 - 33005858
Alignment:
128 aggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttgg 227  Q
    |||||||| ||| |||||||||| |||  ||||||||||||||||  |||||| ||||||||||||||||||||||| | ||||| |||| ||||||| |    
33005736 aggacgtacccgtggaataccgggttctgttcccaggggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttag 33005835  T
228 tgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| ||||||||    
33005836 tgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 20612662 - 20612534
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg--ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccgg-attagtcgccca 220  Q
    |||||||  |||| ||||||||||||| |||||||| ||||  ||||||||  |||||| ||||||||||||||| ||||||||||| |||||||| |||    
20612662 tccaaggttgtattcggggaataccgggttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtcca 20612563  T
221 cctttggtgggtcggaaaccggtgcgaaa 249  Q
    || ||||||||||||||||||||||||||    
20612562 ccattggtgggtcggaaaccggtgcgaaa 20612534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 126 - 250
Target Start/End: Complemental strand, 39807009 - 39806884
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| |||||||||||||| ||||||||||| | ||| |||||||||||| |||||||||||||||| || ||| ||||||||||  |||||||    
39807009 caaggacgtacccggggaataccgggttcgattcccaagagaaacaacgtttggccagtgcgcatgcctctacacacgagtcggattagtcatccacctt 39806910  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    |||||| ||  |||||||||||||||    
39806909 tggtggttcataaaccggtgcgaaag 39806884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 134 - 234
Target Start/End: Complemental strand, 45263783 - 45263682
Alignment:
134 tatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggt 232  Q
    ||||||||||||||||| |||||||||||| |||||||||| |||||| ||||||||||||||||||| ||||||||||| |||| || |||||||||||    
45263783 tatccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggt 45263684  T
233 cg 234  Q
    ||    
45263683 cg 45263682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 152 - 251
Target Start/End: Original strand, 16325603 - 16325703
Alignment:
152 ttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| ||||||  |||||| ||| ||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||    
16325603 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 16325702  T
251 c 251  Q
    |    
16325703 c 16325703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 42770777 - 42770649
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| | |||||||| ||| |||| |||||| ||||||| |||||| |||||||||||||| |||| ||||||||||| ||| |||||    
42770777 tccaaggacgtatccgagaaataccgggttcaattctcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacc 42770678  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| |||||| ||| |||||    
42770677 tttggtgggtcgaaaaccgatgcaaaagc 42770649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 19976933 - 19976806
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| |||||||  |||||| || ||||||||| | ||||||||| |||||||||| || || ||||||||||||||    
19976933 tccaaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcataagtcgaattagtcgcccacc 19976834  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| ||  ||||||| |||||||||||    
19976833 tttgatgaatcggaaatcggtgcgaaag 19976806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 245
Target Start/End: Original strand, 7787040 - 7787158
Alignment:
128 aggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||||| |||||||||||||| ||||||| ||||||| |||||   |||||| || |||||||||||||||| ||||||||||||||||||| |||||    
7787040 aggacgtacccggggaataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttg 7787139  T
227 gtgggtcggaaaccggtgc 245  Q
    |||| ||| ||||||||||    
7787140 gtggatcgaaaaccggtgc 7787158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 13026537 - 13026408
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||| ||||||| ||| |||||||  |||| ||||||| | |||||| ||||||||||||||||||||||||||||||||||  ||||     
13026537 tccaaggacgtatccagggaatatcgggttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcatgagccggattagtcagccact 13026438  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| |||| ||||||| ||| ||||||    
13026437 tttggtaggtcagaaaccgatgcaaaagcc 13026408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 34346413 - 34346284
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||||||||| || || ||||  |||||| ||||||  |||||| ||| ||||||||||||||||||| | ||||| |||| ||||    
34346413 tccaaggacgtacctggggaatactgggtttgattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacc 34346314  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||    
34346313 tttggtgggtcggaaaccggtgcgaaagcc 34346284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 16034917 - 16035044
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| |||||||||| |||||||  |||| ||||||||| ||| || ||| |||||||| |||| | |||||||||||||||| ||||    
16034917 tccaaggacgtatccgaggaataccgggttcgattttcaggcggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcacc 16035016  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||| || ||||||||||||||||||||    
16035017 attgatgagtcggaaaccggtgcgaaag 16035044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 140 - 250
Target Start/End: Complemental strand, 18649136 - 18649025
Alignment:
140 gggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||||| |||||||| |||| |||||||  ||||| | ||||||||||||||||||||||| |||||||||||| ||| |||||||||| |||||    
18649136 gggaataccggattcgattctcaggaggaacaatatttgggcagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggttggaaa 18649037  T
239 ccggtgcgaaag 250  Q
    ||| ||||||||    
18649036 ccgttgcgaaag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 165 - 252
Target Start/End: Complemental strand, 20116696 - 20116609
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||  |||||  ||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||    
20116696 ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagcc 20116609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 124 - 245
Target Start/End: Original strand, 10669572 - 10669694
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||||  |||||| || ||||||||||| |||||||| |||||| ||||||||| ||||||||| ||| ||||||| |||  ||||    
10669572 tccaaggacgtacctgggggctaccgggtttgattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacc 10669671  T
223 tttggtgggtcggaaaccggtgc 245  Q
    |||||||||||||||||||||||    
10669672 tttggtgggtcggaaaccggtgc 10669694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 2528467 - 2528338
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  || |||| ||||| ||||||||||||||| ||||||| |||| | ||| |||||||||||| ||| ||||||||||||||| || |    
2528467 tccaaggacgtactcgaggaacaccgggttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatc 2528368  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||| ||||||||| ||||||||||||    
2528367 tttagtgagtcggaaactggtgcgaaagcc 2528338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 248
Target Start/End: Original strand, 34356186 - 34356311
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||||||| ||||||| ||||||| ||||||  |||| | ||||||||||||||| ||||||||||||||| |||  ||||    
34356186 tccaaggacgtatctggggaataccgggttcgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggattaatcgtgcacc 34356285  T
223 tttggtgggtcggaaaccggtgcgaa 248  Q
     ||| ||||||||||||  |||||||    
34356286 attgatgggtcggaaacgagtgcgaa 34356311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 28616505 - 28616377
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| |||||| |||||| ||| |||||||  |||||| || |||  |||| | ||||||||||||||||||| ||||| ||||||||||||| |    
28616505 tccaaggacatatccgcggaatatcgggttcgattttcagggggaataacacttgggcagtgcgcatgcctctacgcacgagccagattagtcgcccatc 28616406  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||||||| |||||||||||||||||    
28616405 tttagtgggtcagaaaccggtgcgaaagc 28616377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 126 - 249
Target Start/End: Original strand, 2784915 - 2785038
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||| |||||||||  |||||||  ||||| |||||  ||||| | ||||||||||||||||||||||| | ||||||||| ||| | ||    
2784915 caaggacgtatccgaggaataccgagttcgattttcagggaaacaagatttggtcagtgcgcatgcctctacgcatgagtcagattagtcgtccatcatt 2785014  T
226 ggtgggtcggaaaccggtgcgaaa 249  Q
    | || |||||||||||||||||||    
2785015 gatgagtcggaaaccggtgcgaaa 2785038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 44773287 - 44773370
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| ||| ||||||||||  || ||||||||||||||||| |||||||| |||||||||||||||||||||||    
44773287 aacaacgtttggccagtgtgcatgcctctgtgcgtgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag 44773370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 251
Target Start/End: Original strand, 29422197 - 29422323
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| ||||||||||| || ||||||| |||| |||||||||  ||||||  || |||| ||| |||||| ||||||||||||||| |||||||    
29422197 caaggacgtacccggggaatactgggttcgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccggattagtcgtccacctt 29422296  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    || ||| ||||||| ||||||||||||    
29422297 tgatggatcggaaatcggtgcgaaagc 29422323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 126 - 250
Target Start/End: Complemental strand, 3849038 - 3848913
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||| || ||||||||| |||||||  |||||||| |||||||||||| | ||||||| ||||||||| ||| |||||||||||  ||||||    
3849038 caaggacgtatctggagaataccgggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctt 3848939  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    || ||||||| |||  ||||||||||    
3848938 tgatgggtcgaaaattggtgcgaaag 3848913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 171 - 252
Target Start/End: Original strand, 26805324 - 26805405
Alignment:
171 acgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| ||| |||||| ||| ||||||    
26805324 acgtttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccgatgcaaaagcc 26805405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 27725962 - 27726047
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| | |||||| |||||||||||||||||||  ||||||||||||||||||||  |||||||||||||||||||| |||||    
27725962 ggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaag 27726047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 152 - 252
Target Start/End: Original strand, 34722688 - 34722789
Alignment:
152 ttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||| |||||||| |||| | |||| |||| ||||||||| ||||||||||||||||||||||||| ||| || ||||||||||||||||    
34722688 ttcgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaag 34722787  T
251 cc 252  Q
    ||    
34722788 cc 34722789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 183 - 249
Target Start/End: Original strand, 21641990 - 21642056
Alignment:
183 tgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||||||    
21641990 tgcgcatgcctctacgcatgagccgaattaatcgcccgcctttggtgggtcgaaaaccggtgcgaaa 21642056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 29653607 - 29653731
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||  | || |||||||| ||||||| |||||| || ||||| |||| | ||||||||||||||||||| |||||| |||||||| |||||    
29653607 tccaaggacgtactccggaaataccggattcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgcacgagccgaattagtcg-ccacc 29653705  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||    |||||||||||||||||||    
29653706 tttggtg----ggaaaccggtgcgaaagcc 29653731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 152 - 252
Target Start/End: Complemental strand, 28525554 - 28525452
Alignment:
152 ttcgattcccagggg--aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||| |||||||  ||||||  |||||| ||||||||||||||||||| ||||||||||||||  ||||||||  |||||||||||| |||| ||||    
28525554 ttcgatttccagggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtgtgaaa 28525455  T
250 gcc 252  Q
    |||    
28525454 gcc 28525452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 217
Target Start/End: Complemental strand, 21180440 - 21180346
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgc 217  Q
    |||||||||||| |||  ||||||||| ||||||||||| || |||||||  |||||| |||| |||||||||||||| ||||||||||||||||    
21180440 tccaaggacgtacccgaagaataccggattcgattcccatggagaacaacacttggccagtgcacatgcctctacgcacgagccggattagtcgc 21180346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 197 - 250
Target Start/End: Original strand, 792208 - 792261
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||| ||||    
792208 cgcatgagccggattagtcgcccatctttggtgggtcggaaaccggtgcaaaag 792261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 16813253 - 16813164
Alignment:
161 caggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||| || || |||||||||||| ||| ||||||||||||||| ||| ||||||| ||| ||||| | |||||||||    
16813253 caggggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag 16813164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 16852532 - 16852443
Alignment:
161 caggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||| || || |||||||||||| ||| ||||||||||||||| ||| ||||||| ||| ||||| | |||||||||    
16852532 caggggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag 16852443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 37805016 - 37804900
Alignment:
125 ccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||| ||| | |||||||| |||||||| |||||| || |||| |||||  ||||||||||| ||||||||||| | |||| || |||||||     
37805016 ccaaggacgtacccgagaaataccggattcgattcacagggggaataacgcttggctagtgcgcatgccgctacgcatgagtcagatttgttgcccacca 37804917  T
224 ttggtgggtcggaaacc 240  Q
    ||| |||||||||||||    
37804916 ttgatgggtcggaaacc 37804900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 14853491 - 14853363
Alignment:
126 caaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgc--ctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| |||||||||||||||| | |||||||  || |||||||||| ||||||| ||||| ||||  |||||| |||||| ||||||||||| ||| |    
14853491 caaggatgtatccggggaataccagattcgattttcagggggaacaacttttggccagtgcgtatgcctctctactcatgagtcggattagtcgtccatc 14853392  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||| || |||| |||||||||||||    
14853391 tttagtggatc-gaaatcggtgcgaaagcc 14853363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 15234187 - 15234058
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||  | |||||||| || ||||||||||  ||| || |||||||||||||||||||  ||   |||||||||  || |    
15234187 tccaaggacgtacccggggaatactaggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagattagtcgttcatc 15234088  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| | |||||||||||| ||||||||||    
15234087 tttgataggtcggaaaccgatgcgaaagcc 15234058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 25549708 - 25549837
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||||  ||||||||| || ||||||||  |||| || |||| ||||||  |||| |||||||||||||| ||||||||||||||| ||| |    
25549708 tccaagtacgtatttggggaatactgggttcgattcttagggaaaacaacatttggctagtgcacatgcctctacgcacgagccggattagtcgtccatc 25549807  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||| ||| ||| |||||| ||||||    
25549808 tttgatggatcgtaaatcggtgcaaaagcc 25549837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 204
Target Start/End: Original strand, 25604575 - 25604655
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgag 204  Q
    ||||| || ||||||||  |||||||| ||||||| |||||||||||||||||| || ||  |||||||||||||||||||    
25604575 tccaaagatgtatccggaaaataccggattcgatttccaggggaacaacgtttgaccagtatgcatgcctctacgcatgag 25604655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 152 - 252
Target Start/End: Complemental strand, 34130399 - 34130299
Alignment:
152 ttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||  |||| |||||||||||| ||  ||| |||| ||||||||||||||| ||||||||| | ||| ||||| | ||||||| ||||||||||||    
34130399 ttcgattttcaggagaacaacgtttgaccattgcacatgtctctacgcatgagccagattagtcgtctaccattggtagatcggaaatcggtgcgaaagc 34130300  T
252 c 252  Q
    |    
34130299 c 34130299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 34738450 - 34738331
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| ||||||| || ||||||||||| || |||||||| ||||         ||||||||||||| ||| ||||||||||| |||||    
34738450 tccaaggacgtatccgaggaatactggattcgattcccatggagaacaacgcttgg---------atgcctctacgcacgagtcggattagtcgtccacc 34738360  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
      |||| |||||||||||||||| |||||    
34738359 aatggtaggtcggaaaccggtgcaaaagc 34738331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 44193459 - 44193589
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatg---cctctacgcatgagccggattagtcgccc 219  Q
    ||||| |||||||||| |||||||| | |||||||   ||||| ||||||| ||| |||||| | |||   |||||||  | |||| |||||||||||||    
44193459 tccaatgacgtatccgaggaataccaggttcgatttttagggggaacaacgcttgacccgtgtgaatgtctcctctacatacgagctggattagtcgccc 44193558  T
220 acctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| |||||||||| ||||||||||||||||    
44193559 accattggtgggtcagaaaccggtgcgaaag 44193589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 15079463 - 15079558
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcc 218  Q
    |||||||||||| ||||||||||| || ||||||| ||| ||||||||||| ||| || ||| ||||| ||||||||| |||||  ||||||||||    
15079463 tccaaggacgtacccggggaatacagggttcgatttccagggggaacaacgcttgaccagtgtgcatgactctacgcacgagccaaattagtcgcc 15079558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 166 - 252
Target Start/End: Complemental strand, 13104908 - 13104822
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||| ||||||||||||||||||||||||   |||||||| | ||||||| | ||||| |||| |||| |||||||    
13104908 gaacaacgcttggccagtgcgcatgcctctacgcatgagctaaattagtcgtctacctttgataggtcgaaaactggtgtgaaagcc 13104822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 161 - 251
Target Start/End: Original strand, 29421300 - 29421390
Alignment:
161 caggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||| |||| | ||| ||||||||||||||||||| || | |||||| | || |||||| | ||||||||| ||||||||||    
29421300 caggggaacaacgcttgggcagtgagcatgcctctacgcatgagtcgaagtagtcgtctacatttggtagatcggaaaccagtgcgaaagc 29421390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 29697536 - 29697617
Alignment:
155 gattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    ||||||||||||||||||||||| |   |||||||| |||||||||||||   |||||||||| |||||||| ||||||||||    
29697536 gattcccaggggaacaacgtttg-ctaatgcgcatgtctctacgcatgagttagattagtcgctcacctttgctgggtcggaa 29697617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 217
Target Start/End: Original strand, 41187829 - 41187923
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgc 217  Q
    |||||||||||||||| |||||||||  ||| ||||  |||  || ||||| ||| || ||||||||||||||||||||||| ||||||||||||    
41187829 tccaaggacgtatccgaggaataccgaattcaattcttaggaaaaacaacgcttgaccagtgcgcatgcctctacgcatgagacggattagtcgc 41187923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 240
Target Start/End: Complemental strand, 33634549 - 33634448
Alignment:
140 gggaataccggtttcgattcccaggggaac-aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||||| |||||||||||| ||||  ||||||| ||| ||||||||||| || |||| |||||| |||||||  | ||||||||||| ||| |||    
33634549 gggaataccgggttcgattcccagaggaaataacgtttagccagtgcgcatgccgctgcgcacgagccgaattagtcatctacctttggtggatcgaaaa 33634450  T
239 cc 240  Q
    ||    
33634449 cc 33634448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 249
Target Start/End: Complemental strand, 36480502 - 36480438
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||||||||||||||   ||||| ||||||||| ||||||| ||| ||||||||||    
36480502 gtgcgcatgcctctacgcatgagccgg---agtcgtccacctttgatgggtcgaaaatcggtgcgaaa 36480438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 249
Target Start/End: Complemental strand, 1773700 - 1773644
Alignment:
193 tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||  |||||||||| ||||| ||||||||||| ||||||||||||||    
1773700 tctacgcatgagttggattagtcgtccaccattggtgggtcgaaaaccggtgcgaaa 1773644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 44023347 - 44023403
Alignment:
195 tacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||| || |||||||| ||| ||||||||||| ||||||||||||||||||    
44023347 tacgcatgagtcgaattagtcgtccatctttggtgggttggaaaccggtgcgaaagc 44023403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 20963172 - 20963118
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||||||||| ||||| | ||||||||||||||||||| ||||||| ||||||    
20963172 catgcctctacgtatgaggcagattagtcgcccacctttgatgggtcgaaaaccg 20963118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 218 - 252
Target Start/End: Original strand, 29299353 - 29299387
Alignment:
218 ccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||||||||||||||    
29299353 ccacctttggtgggtcggaaaccggtgcgaaagcc 29299387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 199 - 252
Target Start/End: Complemental strand, 44548774 - 44548721
Alignment:
199 catgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||||||||| ||||||||| ||| |||||||| ||||||||||||    
44548774 catgagccagattagtcgtccacctttgatggatcggaaactggtgcgaaagcc 44548721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 200
Target Start/End: Complemental strand, 2149319 - 2149243
Alignment:
126 caaggacgtatccggggaataccggt-ttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgca 200  Q
    |||||| ||||| ||||||||||||  |||||||| | |||| || ||||||||||| |||||||||||||||||||    
2149319 caaggatgtatctggggaataccggagttcgattcactgggggaataacgtttggccagtgcgcatgcctctacgca 2149243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 240
Target Start/End: Original strand, 31088343 - 31088431
Alignment:
152 ttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||||||||||||  ||||||| |||  | ||  ||||||||||||||||||| | |||||| | |||||| ||| |||||||||||||    
31088343 ttcgattcccaggaaaacaacgcttgaacagtatgcatgcctctacgcatgagtcagattagccacccaccattgatgggtcggaaacc 31088431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 31596518 - 31596430
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| |||||||| |||| ||| | ||||||||||||| | |||| ||| | ||||||| ||  | ||||||||||||||||||    
31596518 ggggaacaatgtttggccagtgcacatacttctacgcatgagctgaattaatcgtctacctttgatgaattggaaaccggtgcgaaagc 31596430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 34420227 - 34420310
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||| |||||| | ||| ||||||| ||| ||||||| | |||||||| | ||  ||||||||||||||||||||| ||||||    
34420227 aacaatgtttggtcagtgtgcatgcccctatgcatgagtcagattagtcactcaattttggtgggtcggaaaccggtacgaaag 34420310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 43303379 - 43303292
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||| ||| || || |||||||||||| ||| |||| |||||| ||||||| |  || |||||| |||| ||||||||||    
43303379 aggggaacaacgcttgaccagtacgcatgcctctatgcacgagctggattaatcgcccatcaatgatgggtcagaaatcggtgcgaaa 43303292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 13514048 - 13514102
Alignment:
198 gcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| |||||||| || ||||||||||||||| |||| ||||| ||||||    
13514048 gcatgagccagattagtcaccaacctttggtgggtcgaaaactggtgcaaaagcc 13514102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 249
Target Start/End: Original strand, 29802834 - 29802916
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||| |||| ||||||||||| || || |  |||||||||| |||  ||  |||||| |||||||||||||||    
29802834 aacaacgtttggccagtgcacatgcctctacacacgaactagattagtcgctcactatttatgggtcagaaaccggtgcgaaa 29802916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 201
Target Start/End: Complemental strand, 40969041 - 40968963
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcat 201  Q
    |||||||||||   | ||||||||||| ||||||| ||||||  |||||||||||| | ||||| ||||||||||||||    
40969041 tccaaggacgttctcagggaataccgggttcgatttccagggaaaacaacgtttggtcagtgcgaatgcctctacgcat 40968963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 250
Target Start/End: Original strand, 44997756 - 44997794
Alignment:
212 agtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| |||||| ||||||||||||||||||||||||    
44997756 agtcgcctacctttagtgggtcggaaaccggtgcgaaag 44997794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 5035327 - 5035396
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| ||||||||| || |||||||| ||  ||||||||  |||||||||||||  |||||||||    
5035327 gtgcgcatgtctctacgcacgaaccggattaatcatccacctttaatgggtcggaaacccatgcgaaagc 5035396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 198 - 251
Target Start/End: Complemental strand, 10702227 - 10702174
Alignment:
198 gcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||| ||||||||||  |||||||| ||||||| ||||| |||||||||||    
10702227 gcatgagtcggattagtcatccacctttagtgggtcagaaactggtgcgaaagc 10702174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 30721941 - 30721861
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||  |||| | ||||||||| ||||||| ||||| ||||||||||||||       ||||||| ||||||||||||||||    
30721941 ggggaacaacacttggtcagtgcgcatgtctctacgtatgagtcggattagtcgccc-------gtgggtcagaaaccggtgcgaaag 30721861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 35443925 - 35443873
Alignment:
189 tgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||||||||||||||||||||||||| |||   ||| ||| ||||||||||    
35443925 tgcctctacgcatgagccggattagtcgtccattattgatggatcggaaaccg 35443873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 99)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 47219124 - 47219253
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||| | ||||||||||| ||||| ||||| |||||  ||||||||||||||||||||||||||||||||||| |||||    
47219124 tccaaggacgtatccggggaataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccacc 47219223  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| |||||||||||||||||||||||||    
47219224 tttgatgggtcggaaaccggtgcgaaagcc 47219253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 47749231 - 47749103
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||||| ||||||||||| ||||||||| |||||||||||  |||||| ||||||||||||||||||| |||||| |||||||||||||||    
47749231 tccaaggacgtatccagggaataccgggttcgattcctaggggaacaactcttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacct 47749132  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||| |||||||||||| ||||||||||    
47749131 ttggtaggtcggaaaccgatgcgaaagcc 47749103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 29127899 - 29128028
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||| ||| ||||||| |||||| |||||||  |||| | |||||||||||||||||||||||||||||||||||||||||    
29127899 tccaaggacgtatctggggaatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacc 29127998  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||| ||||||||||    
29127999 tttggtgggtcggaaaccgatgcgaaagcc 29128028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 29135893 - 29136022
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||  |||||    
29135893 tccaaggacgtatccggggaataccggattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccacc 29135992  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||| |||||||||| ||||||||    
29135993 attggtgggttggaaaccggtacgaaagcc 29136022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 7328824 - 7328951
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||| |||||||| ||||||||||||||| ||||||  |||||| |||||||||||| ||||||||||||||||||||||||||||    
7328824 tccaaggacgtacccgggaaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacc 7328922  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| ||||||||||||||||    
7328923 tttggtgggtcgaaaaccggtgcgaaagc 7328951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 54261206 - 54261333
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||||||| ||||||||| ||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||  ||||    
54261206 tccaaggacgtacctggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacc 54261305  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| ||||||||||||||||||||||||    
54261306 tttagtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 3136818 - 3136692
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||| |||||||||||||| |||||||  ||||||||||||  |||| | ||||||||||||||||||||||| ||||||||||| ||||||||    
3136818 caaggacgtacccggggaataccggattcgattttcaggggaacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccaccttt 3136719  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||||||||||||||||||||    
3136718 ggttggtcggaaaccggtgcgaaagcc 3136692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 15320166 - 15320295
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||| | ||| ||||||| | |||||| ||| ||||||||||||||| |||||||||||||||||||||    
15320166 tccaaggacgtacccggggaataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacc 15320265  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||    
15320266 tttggtgggtcagaaaccggtgcgaaagcc 15320295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 28572325 - 28572209
Alignment:
137 ccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg 235  Q
    ||||||||||| || ||||||||||||||||| ||||| |||||| ||  ||||||||||||||| ||||||||||||||||||||||||||||||||||    
28572325 ccggggaatactgggttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgg 28572226  T
236 aaaccggtgcgaaagcc 252  Q
    |||||||||||||||||    
28572225 aaaccggtgcgaaagcc 28572209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 35315936 - 35316063
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||| ||||| ||| ||||||||||||||| ||||||  |||||| |||||||||||||||||||||||| |||||||||||||||     
35315936 tccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccact 35316035  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||| ||||||||    
35316036 tttggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 45877434 - 45877561
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||| ||||  |||||| |||| ||||||||||||||||||||||||||||||  ||||    
45877434 tccaaggacgtatccggggaataccgggttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcacc 45877533  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     ||| |||||||||||||||||||||||    
45877534 attgatgggtcggaaaccggtgcgaaag 45877561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 47471812 - 47471938
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |  ||||||||||| |||||||||||||||||||| | |||||  |||||||||| ||||||||||||||| |||||||| ||||||    
47471812 tccaaggacgtacctagggaataccgggttcgattcccaggggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacct 47471911  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||| ||||||||    
47471912 ttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 25294940 - 25295069
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| || ||||| | |||||| ||||  |||||| ||||||||||||||| ||||||||||||||||||| |||||    
25294940 tccaaggacgtatccggggaataccgggtttgattctctggggaaacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccacc 25295039  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||| |||||||||||||||||||    
25295040 attggtgggttggaaaccggtgcgaaagcc 25295069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 127 - 246
Target Start/End: Original strand, 10040540 - 10040659
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||| |||||||||| ||| |||||||| ||||||||||||| |||||| ||||||||||||||||||| |||||||| | |||| |||||||||    
10040540 aaggacgtacccggggaatatcgggttcgattctcaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggaatggtcgtccacctttg 10040639  T
227 gtgggtcggaaaccggtgcg 246  Q
    |||||| |||||||||||||    
10040640 gtgggttggaaaccggtgcg 10040659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 15795620 - 15795493
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||||||||||||  |||||||||||||||||||||| |||| | ||||||||||||||||||| |||| | ||||||||||||||     
15795620 tccaaggacgtacccggggaataccgagttcgattcccaggggaacaacgcttggtcagtgcgcatgcctctacgcacgagctgaattagtcgcccacca 15795521  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
     |||||||||| |||||||||| |||||    
15795520 atggtgggtcgaaaaccggtgcaaaagc 15795493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 6462392 - 6462518
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||||||| |||||||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||| |||      
6462392 tccaaggacgtatctggggaataccgggttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgaccatt 6462491  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
     || |||||| ||||||||||||||||    
6462492 attagtgggttggaaaccggtgcgaaa 6462518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 13893906 - 13894035
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||| ||||||||||||||| || |||| ||||||| ||||||| |||| |  ||||||||||||||| || |||||||||||||||||||||    
13893906 tccaaggacgtgtccggggaataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacc 13894005  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||| |||||||||||||||||    
13894006 tttggtggatcgaaaaccggtgcgaaagcc 13894035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 33251642 - 33251771
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||  |||||||||||| |||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||     
33251642 tccaaggacgtattaggggaataccgggttcgattcccggtgggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgtccaca 33251741  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||||||| ||||  |||||||||||    
33251742 tttgatgggtcgaaaacgagtgcgaaagcc 33251771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 49543499 - 49543627
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||| ||||||| ||| |||||||| || |||||||||||||||| | ||| ||||||||||||||| |||||| ||||||||||||||    
49543499 tccaaggacgtatcccgggaatatcgggttcgattctcatggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccgaattagtcgcccacc 49543598  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||||||||||||| ||| |||||||    
49543599 tttagtgggtcggaaactggtacgaaagc 49543627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 3507657 - 3507534
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||  | ||||||||||| || |||||| || |||||||||  |||||| ||||||||||||||||||| |||||||||||||||| |||||||    
3507657 aaggacgtacacagggaataccgggtttgattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcaccttt 3507558  T
226 ggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||||||    
3507557 ggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 42412901 - 42412775
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| |||||||||| |||| ||||||| |||||  |||| ||||||||||||||||||||||||||||||| ||||    
42412901 tccaaggacgtatccggggaataccgggttcgattcccggggggaacaacgcttggcaagtgcccatgcctctacgcatgagccggattagtcgctcacc 42412802  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
        ||||||||||||||||||| ||||||    
42412801 ---agtgggtcggaaaccggtgcaaaagcc 42412775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 49198331 - 49198449
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||| ||||||||||||||||| ||||||||| ||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||| |||||    
49198331 tccaaggacatatccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 49198430  T
223 tttggtgggtcggaaaccg 241  Q
     ||||||| || |||||||    
49198431 attggtggatcagaaaccg 49198449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 51683081 - 51682955
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||||||||||||||| | ||||||||||||||| ||||||| ||| || |||||||||||||| | || |||||||||||||||||||||    
51683081 tccaaagacgtatccggggaataccaggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggattagtcgcccacc 51682982  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
      |||||||||||||||| ||||||||    
51682981 aatggtgggtcggaaaccagtgcgaaa 51682955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 124 - 249
Target Start/End: Original strand, 53649707 - 53649833
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||| |||||||| ||||| |||||||  |||||| |||||| || |||||||||||||||||||||||||  ||||    
53649707 tccaaggacgtattcggggaataccgggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacc 53649806  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
    |||| ||| ||||||||||||||||||    
53649807 tttgatggatcggaaaccggtgcgaaa 53649833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 144 - 252
Target Start/End: Original strand, 26043812 - 26043921
Alignment:
144 ataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgg 242  Q
    ||||||| |||||||||||||| |||||||  |||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||    
26043812 ataccgggttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccgg 26043911  T
243 tgcgaaagcc 252  Q
     |||||||||    
26043912 ggcgaaagcc 26043921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 41630639 - 41630510
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||| ||||||| ||||  |||||||| ||| ||||||| ||||||||||| ||| || |||||||||||||||| ||||||||||||||||||||||||    
41630639 tccatggacgtaaccggaaaataccgggttcaattcccaaggggaacaacgcttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacc 41630540  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| |||||||||| |||| |||||||    
41630539 tttggttggtcggaaactggtgtgaaagcc 41630510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 51060408 - 51060279
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||  ||||||||||||| ||| |||||||| |||||| ||||||  |||| | |||||||||||||||||||||| | |||||||||| |||||    
51060408 tccaaggatctatccggggaatatcgggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccacc 51060309  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||||||||||||||    
51060308 attggtgggtcggaaaccggtgcgaaagcc 51060279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 124 - 247
Target Start/End: Complemental strand, 26207928 - 26207804
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| |||||||||||||| ||||||||||| ||||||||||| ||| || ||| ||||||||||||||||||||||||||||||| |||      
26207928 tccaaggatgtacccggggaataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggattagtcggccatt 26207829  T
223 tttggtgggtcggaaaccggtgcga 247  Q
     || |||||||||||||||||||||    
26207828 attagtgggtcggaaaccggtgcga 26207804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 126 - 228
Target Start/End: Original strand, 3755552 - 3755655
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||||||  ||||||||||||| ||||||||||||| || ||||||||| ||||||||||||||||||||||||| | |||||    
3755552 caaggacgtatccggggaataccgacttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctacctt 3755651  T
225 tggt 228  Q
    ||||    
3755652 tggt 3755655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 29762282 - 29762155
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| |||| ||||||||| ||| | |||||| |||||| ||||||  |||||| ||||||||||||||| |||||||| |||||||||| |||||    
29762282 tccaaggatgtattcggggaatatcgggtccgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccacc 29762183  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
     |||||||||||||||||||||||||||    
29762182 attggtgggtcggaaaccggtgcgaaag 29762155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 30767374 - 30767247
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| | |||||||| ||| ||||||| ||||||| ||||||  |||||| ||| ||||||||||||||| |||||||||||||||||||||    
30767374 tccaaggatgtacctggggaatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccacc 30767275  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||  |||||||||    
30767274 tttggtgggtcggaaactagtgcgaaag 30767247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 55069804 - 55069678
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||| | |||||||| || || |||||| |  ||||||||||||||||| |||| |||||||||||||| ||||||||||| |||| ||||||    
55069804 caaggacgtattcagggaatactgggtttgattcctatagggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctt 55069705  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||||| |||||    
55069704 tggtgggtcggaaaccggtgcaaaagc 55069678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 7310830 - 7310701
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| ||||| | | |||||||||| |||||||||||| |||||||||  ||| || ||| ||||||||||||||| |||||||||||||||| || |    
7310830 tccaagaacgtacctgaggaataccgggttcgattcccagtgggaacaacacttgcccggtgtgcatgcctctacgcacgagccggattagtcgctcatc 7310731  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||| ||||||||||    
7310730 tttggtgggtcggaaaccgatgcgaaagcc 7310701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 140 - 251
Target Start/End: Original strand, 7650223 - 7650335
Alignment:
140 gggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||||| ||||||| ||||||| ||||||  |||||| || || ||| ||||||||| ||||||||||||||||||||||||||||||| |||||    
7650223 gggaataccgggttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaa 7650322  T
239 ccggtgcgaaagc 251  Q
    |||||||||||||    
7650323 ccggtgcgaaagc 7650335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 48342000 - 48342128
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||||||| ||| ||||| ||||| ||||||| |||||  |||||||||||||||||||||| || ||||||||| ||| |    
48342000 tccaaggacgtacctggggaataccgggttctattcctagggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcgtccatc 48342099  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| |||||||| |||||||||||    
48342100 tttggtggatcggaaacaggtgcgaaagc 48342128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 162 - 252
Target Start/End: Complemental strand, 26362055 - 26361965
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||| | ||| ||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||| |||||||    
26362055 aggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaaagcc 26361965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 49021271 - 49021201
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||    
49021271 gtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 49021201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 248
Target Start/End: Original strand, 8362571 - 8362682
Alignment:
138 cggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgga 236  Q
    ||||||||||||| ||| |||||||| |||| |||||||||||| || ||||||||||||||||||||||  |||||||| |||||||| |||| || ||    
8362571 cggggaataccgggttcaattcccagtggaaacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccga 8362670  T
237 aaccggtgcgaa 248  Q
    ||||||||||||    
8362671 aaccggtgcgaa 8362682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 141 - 251
Target Start/End: Original strand, 23511564 - 23511675
Alignment:
141 ggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    |||||| ||| |||||||| || ||||| ||||||||| || ||||||||||||||||||||||| ||||||| ||| ||||||||| ||||||| ||||    
23511564 ggaatatcgggttcgattcacaaggggagcaacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaac 23511663  T
240 cggtgcgaaagc 251  Q
    ||||||||||||    
23511664 cggtgcgaaagc 23511675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 54237430 - 54237557
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||||||| |||| |||  ||||||  ||||| |||||||  |||| | ||||||||| ||||||||||||||||||| ||||| ||||| |    
54237430 caaggacgtatccgggaaatatcggggtcgattttcagggagaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccat 54237529  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    | ||||||||||||||||||||||||||    
54237530 tagtgggtcggaaaccggtgcgaaagcc 54237557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 152 - 245
Target Start/End: Complemental strand, 50405702 - 50405608
Alignment:
152 ttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    ||||||||| ||||||| ||||| ||| || ||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||    
50405702 ttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgc 50405608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 221
Target Start/End: Original strand, 39849052 - 39849149
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    ||||||||||||  | ||||||  ||| |||||||||||| ||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||    
39849052 tccaaggacgtactcagggaatttcgggttcgattcccagaggaacaacgcttggccagtgtgcatgcctctacgcatgagccggattagtcgcccac 39849149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 183 - 252
Target Start/End: Original strand, 44064584 - 44064653
Alignment:
183 tgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||    
44064584 tgcgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagcc 44064653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 134 - 245
Target Start/End: Complemental strand, 40660444 - 40660332
Alignment:
134 tatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggt 232  Q
    |||||||| |||||||| ||||||||| ||| |||||||| ||||| | |||||||||||||||||||||| |||||||| ||   ||||||||||||||    
40660444 tatccgggaaataccggattcgattcctaggaggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggt 40660345  T
233 cggaaaccggtgc 245  Q
    || ||||||||||    
40660344 cgaaaaccggtgc 40660332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 137 - 252
Target Start/End: Complemental strand, 45402465 - 45402349
Alignment:
137 ccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg 235  Q
    |||||||||| ||| ||||||||| || |||||||||  | |||| |||||||||||||||||||||||||||||||||||  ||||||| |||||||||    
45402465 ccggggaatatcgggttcgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgg 45402366  T
236 aaaccggtgcgaaagcc 252  Q
    |||| | |||| |||||    
45402365 aaactgatgcgcaagcc 45402349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 162 - 252
Target Start/End: Original strand, 8164572 - 8164662
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||| |||||| |||||||||||| |||||| ||| ||||||||||||||||||||||||| ||||||| ||| | |||||||    
8164572 aggggaacaacgcttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtggatcggaaatcggcgtgaaagcc 8164662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 251
Target Start/End: Original strand, 31072860 - 31072986
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| |||| ||||||| | ||||||| ||||||| ||||||| |||| | |||| |||||||||||||| || || ||||| ||| |||||||    
31072860 caaggacgtacccggagaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccagattaatcgtccacctt 31072959  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| ||||||||||||||||||    
31072960 tggtaggttggaaaccggtgcgaaagc 31072986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 194 - 252
Target Start/End: Complemental strand, 36043730 - 36043672
Alignment:
194 ctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
36043730 ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 36043672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 43330800 - 43330730
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||  |||||||| ||||||||    
43330800 gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtacgaaagcc 43330730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 124 - 237
Target Start/End: Complemental strand, 52364927 - 52364813
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||  ||||||||||||  ||||||||| ||| || ||||||||||||||||||| |||| |||||| ||| | |||    
52364927 tccaaggacgtacccggggaataccgagttcgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattaatcgtctacc 52364828  T
223 tttggtgggtcggaa 237  Q
    |||| ||||||||||    
52364827 tttgatgggtcggaa 52364813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 928580 - 928709
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |  ||||||||| | |||||||| |||||| ||||||  ||| || ||||||||||| ||||||| ||||||||||||||  |||||    
928580 tccaaggacgtacctagggaataccagattcgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtcatccacc 928679  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| |||| ||| |||||||||||||    
928680 tttggtgagtcgaaaatcggtgcgaaagcc 928709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 133 - 250
Target Start/End: Original strand, 22909773 - 22909890
Alignment:
133 gtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggt 232  Q
    |||||||| ||||| ||| |||||||| ||| ||||||||| | |||  |||||||| | ||||||||||||||| ||||||||  |||||||| |||||    
22909773 gtatccggagaatatcgggttcgattctcagaggaacaacgctaggctagtgcgcatacttctacgcatgagccgaattagtcgtgcacctttgatgggt 22909872  T
233 cggaaaccggtgcgaaag 250  Q
    |||||||| |||||||||    
22909873 cggaaaccagtgcgaaag 22909890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 147 - 252
Target Start/End: Complemental strand, 24506751 - 24506646
Alignment:
147 ccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg 246  Q
    |||| |||||||  ||||| ||||||| ||| || |||| |||||||||||||||||| | |||||||||| |||| ||||||||||||||||||||||     
24506751 ccgggttcgattttcagggaaacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgca 24506652  T
247 aaagcc 252  Q
    ||||||    
24506651 aaagcc 24506646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 30045816 - 30045929
Alignment:
139 ggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    |||||||||||| ||||||||| ||||| ||||||| |||||| ||||||||| ||||||||| ||| | ||||||||| ||||||||| ||||||| ||    
30045816 ggggaataccgggttcgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaa 30045915  T
238 accggtgcgaaagc 251  Q
    ||  ||||||||||    
30045916 actagtgcgaaagc 30045929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 125 - 245
Target Start/End: Original strand, 33688932 - 33689053
Alignment:
125 ccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||| |||||||| ||| ||| ||||| | |||||| |||  |||||| ||||||||||||||||||||||||| | ||||||  |||||     
33688932 ccaaggacgtatcgggggaatatcgggttcaattcctaaggggaataacacttggccagtgcgcatgcctctacgcatgagccagtttagtcatccacca 33689031  T
224 ttggtgggtcggaaaccggtgc 245  Q
    ||||||||| ||||||||||||    
33689032 ttggtgggttggaaaccggtgc 33689053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 7648760 - 7648848
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||| || |||||||| |||||||||| ||||||||||||||||||||||||| ||||||| || ||  |||||||||    
7648760 ggggaacaacgtttgaccagtgcgcatacctctacgcacgagccggattagtcgcccacctttgttgggtcgaaatccaatgcgaaagc 7648848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 250
Target Start/End: Complemental strand, 45450567 - 45450447
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    ||||||||||  |||||| || || |||| |||||||||||| | ||| || |||||||||||||||||||| |||  ||||||||| ||||||||| ||    
45450567 gacgtatccgtagaatactgggtttgatttccaggggaacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatg 45450468  T
230 ggtcggaaaccggtgcgaaag 250  Q
     || |||||||||||||||||    
45450467 agttggaaaccggtgcgaaag 45450447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 152 - 248
Target Start/End: Original strand, 4638162 - 4638259
Alignment:
152 ttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 248  Q
    ||||||||||||| ||| ||||| ||| || |||||||| |||||||||| ||||||||||||| ||||||||||  |||||||||||||| ||||||    
4638162 ttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa 4638259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 19146983 - 19147068
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||| |||||| ||| | || |||||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||||    
19146983 ggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 19147068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 32873675 - 32873571
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||| |||||| | ||||||||| |||| |||||||| ||| || |||| |||||||||||| ||||||| |||||||||||||||    
32873675 tccaaggacgtacccggg-aataccaggttcgattcctagggagaacaacgcttgaccagtgcacatgcctctacgtatgagccagattagtcgcccacc 32873577  T
223 tttggt 228  Q
    ||||||    
32873576 tttggt 32873571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 162 - 250
Target Start/End: Original strand, 13367443 - 13367531
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||| |||| | ||| |||||||| ||||||||||||||||||||| || ||| ||| ||||| |||||||||||||||||    
13367443 aggggaacaacgcttggtcagtgtgcatgcctttacgcatgagccggattagtcacctaccgttgttgggtaggaaaccggtgcgaaag 13367531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 35998697 - 35998569
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||| |||||| |||| ||||||||| || |||| | |||| ||||||| |||  | |||| |||||||||||||| |||  |||||| ||| ||||||    
35998697 tccaaagacgtacccggagaataccgggtttgatttcgagggaaacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacct 35998598  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    || ||||||| ||||||||||||||||||    
35998597 ttagtgggtcagaaaccggtgcgaaagcc 35998569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 217
Target Start/End: Original strand, 28242258 - 28242352
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgc 217  Q
    ||||| ||||||||||| ||||||||| || |||| ||||| ||||||| |||||||| |||| |||||||||| ||||||| ||||||||||||    
28242258 tccaatgacgtatccggagaataccgggttagattgccaggaggaacaatgtttggccagtgcacatgcctctatgcatgaggcggattagtcgc 28242352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 182 - 252
Target Start/End: Complemental strand, 34374510 - 34374440
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||| |||||| || ||||||||||||||  ||||||||||||||||||||||| |||||||    
34374510 gtgcgcatgcctcaacgcataagtcggattagtcgcccttctttggtgggtcggaaaccggtgtgaaagcc 34374440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 245
Target Start/End: Complemental strand, 35923750 - 35923628
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | || ||||||| | ||||||||  ||||| |||||||||||||| ||||||||||||||| ||| ||| || |||||||| ||| |    
35923750 tccaaggacgtacctggagaataccaggttcgattcatagggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcgaattagtcgtccatc 35923651  T
223 tttggtgggtcggaaaccggtgc 245  Q
    |||| ||| ||| ||||||||||    
35923650 tttgatggatcgaaaaccggtgc 35923628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 124 - 233
Target Start/End: Original strand, 40944863 - 40944972
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||| | ||||||||  ||||||||||||||| ||||||  ||  || ||  |||||||||||||||||||| ||||||||||| ||||    
40944863 tccaaggacgtatccagagaataccgagttcgattcccagggggaacaacacttaaccagtatgcatgcctctacgcatgagc-ggattagtcgctcacc 40944961  T
223 tttggtgggtc 233  Q
    |||||||||||    
40944962 tttggtgggtc 40944972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 138 - 252
Target Start/End: Original strand, 19873361 - 19873481
Alignment:
138 cggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctac------gcatgagccggattagtcgcccacctttggtggg 231  Q
    ||||||||||| | || ||||||||| ||||||| | |||||| ||||||||||||||||      ||| ||||||||||||||| ||| |||| |||||    
19873361 cggggaataccaggtttgattcccagaggaacaatgcttggccagtgcgcatgcctctacctctacgcacgagccggattagtcgtccatcttttgtggg 19873460  T
232 tcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||||| ||||||    
19873461 tcggaaactggtgcaaaagcc 19873481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 117 - 249
Target Start/End: Complemental strand, 34662453 - 34662320
Alignment:
117 gagctcgtccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtc 215  Q
    |||||| ||||||||||||   |||||||| ||| |||||||  |||| |||| ||||||||| | || |||||| ||||| |||||||||| |||||||    
34662453 gagctcttccaaggacgtacttggggaatatcgggttcgattttcaggaggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtc 34662354  T
216 gcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    | |||||||| |||| | |||||||| |||||||    
34662353 gtccacctttagtggattggaaaccgatgcgaaa 34662320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 251
Target Start/End: Original strand, 41219576 - 41219700
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||| |||| ||||||   |||||||| |||| |||||||||||||||| ||||| |||||||| |||| |||| |||||| || | |||||||    
41219576 aaggacgtatacggg-aataccaagttcgattctcaggaggaacaacgtttggccagtgcgtatgcctctgcgcacgagctggattaatcactcaccttt 41219674  T
226 ggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||| ||||| ||||||||||    
41219675 ggtggatcgtaaaccagtgcgaaagc 41219700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 124 - 232
Target Start/End: Complemental strand, 47303616 - 47303507
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||||  |||| ||| || |||||||||| ||||||||  |||| | |||| ||||||||||| |||||||||||||||||| | |||    
47303616 tccaaggacgtatccggaaaatatcgggtttgattcccaggaggaacaacacttggtcagtgcacatgcctctacacatgagccggattagtcgtcaacc 47303517  T
223 tttggtgggt 232  Q
    ||||| ||||    
47303516 tttggcgggt 47303507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 185 - 249
Target Start/End: Complemental strand, 2029332 - 2029268
Alignment:
185 cgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||||||||||||| |||||||||||||||| ||| ||||||| ||||| ||||||||    
2029332 cgcatgcctctacgcatgagctggattagtcgcccaccattgatgggtcgcaaaccagtgcgaaa 2029268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 175 - 251
Target Start/End: Original strand, 2668093 - 2668169
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| ||||||||||||||||||| |||| ||||||||||| ||||||| |||||| ||||| | ||||||||||    
2668093 ttggccagtgcgcatgcctctacgcaagagctggattagtcgctcacctttagtgggttggaaatcagtgcgaaagc 2668169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 126 - 222
Target Start/End: Original strand, 3763033 - 3763129
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||||| |||||||| |||||||| ||| ||||||||| |||| | ||| ||||| ||||||||| || | |||||||||| |||||    
3763033 caaggacgtatccgggaaataccggattcgattcacagaggaacaacgcttggtcagtgtgcatgtctctacgcacgaactggattagtcgtccacc 3763129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 225
Target Start/End: Original strand, 49082807 - 49082906
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||||||||||||  |||||||||||||| |||||||| || ||| |||||||||| ||||| || ||  | |||||||| |||||||||    
49082807 aaggacgtatccggggaataccgagttcgattcccagggagaacaacgcttagccagtgcgcatgcatctacacacgaatcagattagtcacccaccttt 49082906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 47164152 - 47164214
Alignment:
189 tgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| |||||||||||||||| || ||||||||| ||||||||||||| ||||||    
47164152 tgcctctacgcacgagccggattagtcgctcatctttggtggatcggaaaccggtgtgaaagc 47164214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 10043721 - 10043790
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||||||||| ||| | ||||| |||| |||| ||||||||||||||||||||||||||||    
10043721 gtgcacatgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaagc 10043790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 38394300 - 38394175
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |  ||||||||||| |||||| |||||||| ||||| | |||  ||||| |||  ||||||||||||||||||||||| ||||||    
38394300 tccaaggacgtatctgaagaataccggtt-cgattctcaggggaaacaacgctcggca-gtgcgtatgtttctacgcatgagccggattagtcacccacc 38394203  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
      ||||||||| || ||||||| |||||    
38394202 agtggtgggtcagagaccggtgtgaaag 38394175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 240
Target Start/End: Complemental strand, 8683291 - 8683250
Alignment:
199 catgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||||||||||||||||| |||||||||||||||||||||||    
8683291 catgagccggattagtcgtccacctttggtgggtcggaaacc 8683250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 21325123 - 21325172
Alignment:
202 gagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| ||||||| ||||| ||||||||||||||||||||||||    
21325123 gagccggattaatcgcccatctttgatgggtcggaaaccggtgcgaaagc 21325172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 187 - 252
Target Start/End: Complemental strand, 29195382 - 29195317
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||| || ||||||||| |||||||| |||||| |||||||||| ||||||||    
29195382 catgcctctacacatgaaccagattagtcgtccacctttagtgggttggaaaccggtacgaaagcc 29195317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 50753405 - 50753340
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||| ||| |||||||||||  || | |||||||||||||||||||||| |||||    
50753405 gcatgcctctacgcacgagtcggattagtcgttcatcattggtgggtcggaaaccggtgcaaaagc 50753340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 124 - 215
Target Start/End: Complemental strand, 11687236 - 11687144
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtc 215  Q
    |||||||||||| | || ||||||||| || ||||| |||||| ||||| | |||||| ||||||||||||||||| ||||| | ||||||||    
11687236 tccaaggacgtacctggagaataccgggtttgattctcagggggaacaatgcttggccagtgcgcatgcctctacgtatgagtcagattagtc 11687144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 166 - 252
Target Start/End: Complemental strand, 15085029 - 15084943
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||| ||| |||| |||||||| | ||||  ||||||||| | | ||||||||| ||||||||||||| |||||||    
15085029 gaacaacggttggccagtgtgcatacctctacgtacgagctagattagtcgtctatctttggtggatcggaaaccggtgtgaaagcc 15084943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 245
Target Start/End: Complemental strand, 22405669 - 22405548
Alignment:
125 ccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||| |||||||||| | |||||||| ||| |||| |||| ||||||||| ||  ||  |||| |||||| || ||| ||||||||||| ||| ||| ||    
22405669 ccaatgacgtatccgtgaaataccggattctattctcaggaggaacaacgcttaaccaatgcgaatgcctttatgcacgagccggattaatcgtccatct 22405570  T
224 ttggtgggtcggaaaccggtgc 245  Q
    |||||| |||||||||| ||||    
22405569 ttggtgcgtcggaaaccagtgc 22405548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 140 - 249
Target Start/End: Complemental strand, 25515858 - 25515749
Alignment:
140 gggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    ||||||||||| ||| ||| | |||||||||| |||||||  |||  ||||| |||||| |||||  ||||||||||| |||| || |||| ||||||||    
25515858 gggaataccgggttctattactaggggaacaatgtttggctagtgtacatgcttctacgtatgagttggattagtcgctcaccattagtggatcggaaac 25515759  T
240 cggtgcgaaa 249  Q
     | |||||||    
25515758 tgatgcgaaa 25515749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 152 - 245
Target Start/End: Complemental strand, 41223136 - 41223043
Alignment:
152 ttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    |||||||  ||||| ||||||||||||||  ||||||||||||||||||| || | ||||| ||||| | ||||  ||| ||||||| ||||||    
41223136 ttcgattatcagggaaacaacgtttggccaatgcgcatgcctctacgcataagtctgattaatcgcctatctttaatggatcggaaatcggtgc 41223043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 222
Target Start/End: Original strand, 7139735 - 7139831
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||||||||| |||||||||||| ||||||| |  ||| || |||  |||  ||||||||| |||| |||||| |||||||||    
7139735 aaggacgtatccagggaataccgggttcgattcccagagggaacatcacttgaccagtgtacatatctctacgcacgagctggattaatcgcccacc 7139831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 143 - 218
Target Start/End: Original strand, 10855383 - 10855459
Alignment:
143 aataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcc 218  Q
    |||||||| || |||| ||||||| ||||||| |||||| || |||||||||||||||| || ||| ||||||||||    
10855383 aataccgggtttgatttccagggggaacaacgcttggccagtacgcatgcctctacgcacgaaccgaattagtcgcc 10855459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 251
Target Start/End: Complemental strand, 52168669 - 52168569
Alignment:
152 ttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| |||||| |||||| ||||||||  |||||||||| | || ||||||||||||||||||  |||  ||| ||||||| |||||| ||| ||||    
52168669 ttcgatttccagggtgaacaatgtttggccaatgcgcatgccccaacacatgagccggattagtcgttcacaattgatgggtcgaaaaccgatgctaaag 52168570  T
251 c 251  Q
    |    
52168569 c 52168569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 34460594 - 34460547
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattag 213  Q
    ||||||||||||||| ||| ||||||||| ||||| ||||||||||||    
34460594 gaacaacgtttggccagtgtgcatgcctccacgcacgagccggattag 34460547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 190
Target Start/End: Complemental strand, 37092632 - 37092565
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatg 190  Q
    |||||||||||| ||| |||||| ||| || |||| ||| |||||||||||||||||| |||||||||    
37092632 tccaaggacgtacccgtggaatatcggattagatttccaaggggaacaacgtttggccagtgcgcatg 37092565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 189
Target Start/End: Complemental strand, 7613053 - 7612987
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcat 189  Q
    ||||||||||||   |||||||||||| ||||||||||| ||||||||||| |||||  ||||||||    
7613053 tccaaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttggctagtgcgcat 7612987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 10043132 - 10043186
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcc 180  Q
    ||||||||||||||||||||| ||| ||||||||||| | |||||| | ||||||    
10043132 caaggacgtatccggggaatatcgggttcgattcccaagagaacaatgcttggcc 10043186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 249
Target Start/End: Complemental strand, 11393526 - 11393476
Alignment:
199 catgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||| ||||||||| ||||||||| | |||||||||||| |||||||    
11393526 catgagccagattagtcgtccacctttgattggtcggaaaccgatgcgaaa 11393476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 26590391 - 26590265
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||| |||  |||||  || |||||||| |||||| ||||||| |||| | ||| |||||||||||| || ||||  ||||| |||  |   ||    
26590391 caaggacgtacccgaagaatattgggttcgattctcagggggaacaacgcttggtcagtgtgcatgcctctacacacgagctagattaatcgatcgtatt 26590292  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| ||||||||||||||||||||    
26590291 tggtggatcggaaaccggtgcgaaagc 26590265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 32522018 - 32522076
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||||||||  | |||||||||| | ||||||||| ||||||||| |||||||||||||    
32522018 gtgcgcatgtatttacgcatgagtcagattagtcgtccacctttgatgggtcggaaacc 32522076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 185
Target Start/End: Complemental strand, 11025499 - 11025438
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgc 185  Q
    |||||||||||||| |||||||||| | ||||||||| ||||| |||||  |||||| ||||    
11025499 tccaaggacgtatctggggaataccaggttcgattccgagggggacaacacttggccagtgc 11025438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 238
Target Start/End: Complemental strand, 24146393 - 24146340
Alignment:
185 cgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||||||||  ||||||||| |||||||| ||||| ||| |||||||||||    
24146393 cgcatgcctctagacatgagccgaattagtcgtccaccattgatgggtcggaaa 24146340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 186 - 250
Target Start/End: Complemental strand, 37319953 - 37319889
Alignment:
186 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||| |||| | |||| ||| ||||| ||| ||||| |||||| ||||||||||    
37319953 gcatgcctctacgcacgagctgaattaatcgtccaccgttgatgggttggaaactggtgcgaaag 37319889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 98)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 127 - 251
Target Start/End: Complemental strand, 9659302 - 9659178
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    |||||||||  ||||||||||||| |||||||||||||||||||||||||| |  |||||||||||| |||||||||||||||||||||| |||||||||    
9659302 aaggacgtactcggggaataccgggttcgattcccaggggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttg 9659203  T
227 gtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| ||||||||||||||||||    
9659202 gtgggttggaaaccggtgcgaaagc 9659178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 11398015 - 11397888
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||| |||||||| ||||||||| ||||||||| |||||||||||||||||||  |||| ||||||||||||||||| ||||||||||| ||||||    
11398015 tccaaggatgtatccggagaataccgggttcgattccgaggggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacct 11397916  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||| ||||||||||||    
11397915 ttggtgggtcggaaatcggtgcgaaagc 11397888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 41663980 - 41663854
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||  |||| | |||||||||||||||||||||||| |||||||||| ||||| ||    
41663980 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccatt 41663881  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||||||    
41663880 ggtgggtcggaaaccggtgcgaaagcc 41663854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 49078098 - 49078224
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||||||||||||||| ||||||||||||||||| ||||  |||||| |||||||||||||||||||||||||||||||||||  |||| ||    
49078098 aaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccatt 49078197  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||||||||||||||||||||    
49078198 ggtaggtcggaaaccggtgcgaaagcc 49078224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 5855503 - 5855631
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||| ||||||||||||| ||||||||| |||||| ||||||||||||||||||||||| |||||||||||  ||||    
5855503 tccaaggacgtattcggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacc 5855602  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||||||||||||||| |||||||||    
5855603 tttagtgggtcggaaaccgatgcgaaagc 5855631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 26325795 - 26325922
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||||| |||||| ||| |||||||||||| |||||||||  |||| | ||||||||||||||||||||||||||||||||||| ||||| |    
26325795 caaggacgtatccgaggaatatcgggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccat 26325894  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||    
26325895 tggtgggtcggaaaccggtgcgaaagcc 26325922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 37339800 - 37339930
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggga--acaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    |||||||| ||| |||||||||||||| |||||||||||||||   |||||| |||||| ||||||||||||| ||||| ||||||||||||||||||||    
37339800 tccaaggatgtacccggggaataccgggttcgattcccagggggggacaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccac 37339899  T
222 ctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| |||||||||||||||||||    
37339900 ctttggtgggttggaaaccggtgcgaaagcc 37339930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 8763972 - 8764101
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||| ||| |||| |||||||||| ||||||  |||||| ||||||||||||||||||| ||||||||||||||| |||||    
8763972 tccaaggacgtacccggggaatatcgggttcgtttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacc 8764071  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||||||||||||||||||||||    
8764072 gttggtgggtcggaaaccggtgcgaaagcc 8764101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 18915848 - 18915977
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| ||||||||||||||| ||||||  |||||| ||| ||||||||||||||| |||||||||||||||| ||||    
18915848 tccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcacc 18915947  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     ||||||||| |||||||||||||||||||    
18915948 attggtgggttggaaaccggtgcgaaagcc 18915977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 43959948 - 43959819
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||| |||||||||| ||| ||| ||||||||||| ||||||| |||||| ||||||||||||||||||| |||||||||||||||||||||    
43959948 tccaatgacgtacccggggaatatcgggttcaattcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacc 43959849  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||| |||||||||||||||||||||    
43959848 tttagtggatcggaaaccggtgcgaaagcc 43959819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 10173098 - 10172970
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| |||||||||||| ||| |||||||    |||||||| |||||| |||| |||||||||||||||||||||||||| |||||||||    
10173098 tccaaggacgtatctggggaataccggattcaattcccataaagaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacc 10172999  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
10172998 tttggtgggtcggaaaccggtgcgaaagc 10172970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 10422769 - 10422897
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||| ||||||||||||| ||||||| | ||| ||||||||  |||||| ||||||||||||||||||||||||||||||||||| |||||    
10422769 tccaatgacgtattcggggaataccgggttcgatttctaggaggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 10422868  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||  |||||||||||||||||||||    
10422869 tttggtaagtcggaaaccggtgcgaaagc 10422897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 16956447 - 16956575
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||  |||| ||| |||||| ||||||||||| || ||||||||||||||||||| |||||||||||||| | ||||    
16956447 tccaaggacgtacccggggaataccgtgttcggttctcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcacc 16956546  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||| ||||||||||    
16956547 tttggtgggtcggaaaccagtgcgaaagc 16956575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 45362009 - 45361881
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| || ||||||||||| |||||||| |||| ||||||||| |||||| ||||||||||| |||||||| ||||||||||||||  ||||    
45362009 tccaaggacgtaccctgggaataccgggttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacc 45361910  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| |||||||||||||||||||||||||    
45361909 tttagtgggtcggaaaccggtgcgaaagc 45361881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 33004142 - 33004015
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||| ||| ||||||| ||||||||| ||| | |||||| ||||||||||||||||||| |||||||||||||| ||||||    
33004142 tccaaggacgtatccggggaatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccacc 33004043  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
      |||||||||| |||||||||||||||    
33004042 aatggtgggtcgaaaaccggtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 130 - 251
Target Start/End: Original strand, 26660125 - 26660246
Alignment:
130 gacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    ||||||| ||||||||||||| ||||||| ||| |||||||||| ||||  | || |||||||||||||||||||||||||||||||| |||||||||||    
26660125 gacgtattcggggaataccgggttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggt 26660223  T
229 gggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||    
26660224 gggtcggaaaccggtgcgaaagc 26660246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 50503486 - 50503360
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||||||||||||| ||| ||||||||||||||| ||||||  ||| || ||||||||||||||||||| |||||||||| ||||||||||      
50503486 caaggacgtatccggggaatatcgggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgcacgagccggatttgtcgcccaccaa 50503387  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||| |||||||||    
50503386 tggtgggtcggaaaccgatgcgaaagc 50503360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 17642131 - 17642002
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||| ||||||| || || ||||| || ||||||||||||||| ||||||  |||||| ||||||||||||||||||| ||||||||||||||| |||||    
17642131 tccacggacgtacccaggaaatactgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacc 17642032  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||| ||||||||||||    
17642031 tttggtgggtcggaaactggtgcgaaagcc 17642002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 16263528 - 16263653
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||| |||||||||| | ||||||| ||||| ||||||||| |||||| |||||||||||||||||||| ||||||| |||||| |||| ||    
16263528 caaggacgtatctggggaataccaggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttt 16263627  T
225 tggtgggtcggaaaccggtgcgaaag 250  Q
    || ||| |||||||||||||||||||    
16263628 tgatggatcggaaaccggtgcgaaag 16263653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 14254395 - 14254278
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||  |||||||  |||||| ||||||| |||||| || ||||||||| |||||||||||||||||||||| |||||    
14254395 tccaaggacgtattcggggaataccgagttcgattttcagggggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcgtccacc 14254296  T
223 tttggtgggtcggaaacc 240  Q
    |||| |||||||||||||    
14254295 tttgatgggtcggaaacc 14254278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 34719757 - 34719886
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||||||||| || |||||||||||  ||||| |||| ||| || ||||||||||||||||||| ||| | |||||||||| ||||    
34719757 tccaaggacgtacctggggaatactgggttcgattcccactgggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacc 34719856  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||| ||||||||||||    
34719857 tttggtgggtcggaaactggtgcgaaagcc 34719886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 2981058 - 2980930
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||| ||||||||||||||||||| || |||||||||||| |||||||||  |||||| ||| ||||||||||||||| ||| ||||||||||| |||      
2981058 tccagggacgtatccggggaatactgggttcgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatg 2980959  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| |||||||||||| ||||||||||||    
2980958 tttagtgggtcggaaatcggtgcgaaagc 2980930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 30927854 - 30927726
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | ||| |||| ||| ||||||| |||| |||||||||| ||||||  || ||||||||||||||||||||||||||||||| ||||     
30927854 tccaaggacgtacctgggaaatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccact 30927755  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| ||||||||||| |||||    
30927754 tttggtgggtcagaaaccggtgcaaaagc 30927726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 40288604 - 40288476
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||||||||||||| ||||||| ||||||| ||||||| |||||| ||  |||||||||||| || |||||||||||||||| || |    
40288604 tccaaggacgtattcggggaataccgggttcgatttccagggggaacaacggttggccagtatgcatgcctctacacacgagccggattagtcgctcatc 40288505  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     ||||||||||||||||| |||| |||||    
40288504 cttggtgggtcggaaaccagtgcaaaagc 40288476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 216
Target Start/End: Complemental strand, 47313025 - 47312933
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    |||||||||||||| |||||||||||| || |||||| ||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||    
47313025 tccaaggacgtatctggggaataccgggtttgattcctaggggaacaacgtttggccagtgcgtatgcctctacgcatgagccagattagtcg 47312933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 152 - 250
Target Start/End: Complemental strand, 21849303 - 21849205
Alignment:
152 ttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||||||| |||||  ||||||||||||||||||| |||||||||||||||| |||  ||||||||||| |||||||| ||||||    
21849303 ttcgattcccaggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacgaaag 21849205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 240
Target Start/End: Complemental strand, 33418242 - 33418125
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggga-acaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| |||||| |||| ||||||||| ||||||||| |||||  |||||| |||||| ||||||||||||||| ||| ||||||||||||||| |||||    
33418242 tccaaagacgtacccggagaataccggattcgattcctaggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcgtccacc 33418143  T
223 tttggtgggtcggaaacc 240  Q
    |||||| |||||||||||    
33418142 tttggtcggtcggaaacc 33418125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 175 - 251
Target Start/End: Complemental strand, 4581757 - 4581681
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||| ||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||    
4581757 ttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4581681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 32142972 - 32142845
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| || || |||||||| |||||||  |||||| ||||||  |||||| |||||||||||| ||||||||||||| ||||||||| ||||    
32142972 tccaaggacgtaccctgg-aataccgggttcgattttcagggggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacc 32142874  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| |||||||||||||| |||||||||    
32142873 tttgatgggtcggaaaccgatgcgaaagc 32142845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 45726560 - 45726433
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||| |||||||| | |||||||| |||| |||| ||| ||||||| ||||| ||| |||||||||||||||||||||||||  ||||    
45726560 tccaaggacgtacccgaggaatacctggttcgattctcaggaggaataacatttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacc 45726461  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||| || ||||||||||    
45726460 tttggtggatcggagactggtgcgaaag 45726433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 131 - 252
Target Start/End: Original strand, 34697323 - 34697445
Alignment:
131 acgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    |||||| ||||||||||| | ||||||||  ||||| ||||||  |||||  ||| |||||||||||||||||||||||||||||||||||| |||| ||    
34697323 acgtattcggggaataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatg 34697422  T
230 ggtcggaaaccggtgcgaaagcc 252  Q
    ||| |||||||| ||||||||||    
34697423 ggttggaaaccgatgcgaaagcc 34697445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 143 - 251
Target Start/End: Complemental strand, 33498947 - 33498838
Alignment:
143 aataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||||| |||||||| |||| ||| ||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||| ||| ||| ||    
33498947 aataccgggttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatggatcgtaaagcg 33498848  T
242 gtgcgaaagc 251  Q
    || |||||||    
33498847 gtacgaaagc 33498838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 143 - 252
Target Start/End: Original strand, 44969665 - 44969774
Alignment:
143 aataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgg 242  Q
    |||||| | |||||||| |||| |||||||| |||||| ||| ||||||| ||||||||||||||||||||||| ||| | ||||||| |||||||||||    
44969665 aataccaggttcgattctcaggagaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccgg 44969764  T
243 tgcgaaagcc 252  Q
    || |||||||    
44969765 tgtgaaagcc 44969774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 15465946 - 15466074
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||  |||||||||| | ||||||| ||||||| ||||||| |||| | |||| |||||||||||||| ||| | |||| ||||| ||||    
15465946 tccaaggacgtatttggggaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacc 15466045  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||| | |||||||    
15466046 tttggtgggtcggaaaccgatacgaaagc 15466074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 32151049 - 32150921
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||| | || |||||| | | ||||||| ||||||| |||||| ||||| | |||||||||||| ||||||||||||| ||||||||| ||||    
32151049 tccaaggacgttttcgaggaatatcaggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacc 32150950  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||||||| |||||| |||||||||    
32150949 tttgatgggtcgaaaaccgatgcgaaagc 32150921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 892422 - 892300
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    ||||||||||| ||||||||||||| ||||||||| ||||| ||||||  || |||  || |||||||     |||||||||||||||||||||||||||    
892422 caaggacgtattcggggaataccgggttcgattcctagggggaacaacacttagccaatgtgcatgcc-----gcatgagccggattagtcgcccacctt 892328  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||| ||||||| |||||||||||||    
892327 tggtggatcggaaatcggtgcgaaagcc 892300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 250
Target Start/End: Complemental strand, 18649479 - 18649352
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| || ||||| ||| |||||||  |||||| ||||||| ||| || ||||||||||||||||| | ||||| ||||| |||||||||    
18649479 tccaaggacgtatctggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaatcgcccacc 18649380  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||| |||| | |||||||||||||||||    
18649379 tttagtggattggaaaccggtgcgaaag 18649352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 124 - 241
Target Start/End: Original strand, 10336497 - 10336615
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||| ||||||||||| ||||| ||| |||||||  |||||| ||||||| ||| || ||||||||||||||||||||||||||||||| ||| |||||    
10336497 tccaaagacgtatccggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatcgtccacc 10336596  T
223 tttggtgggtcggaaaccg 241  Q
    |||| ||| ||| ||||||    
10336597 tttgatggatcgaaaaccg 10336615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 50094925 - 50095014
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||| || || ||||||| |||||||||||| ||||||||||| ||||| || ||||||||||||||||||| ||||||    
50094925 ggggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgcaaaagcc 50095014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 32852 - 32980
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| | |||||||| ||| | ||||||||||| ||||||||| |||| | |||| ||||||||||||||||||||| |||||||| | ||     
32852 tccaaggacgtaccgggggaatatcgggtccgattcccaggaggaacaacgcttggtcagtgcacatgcctctacgcatgagccgaattagtcgtctact 32951  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||| ||| |||||||||| | |||||||    
32952 tttgatggatcggaaaccgatacgaaagc 32980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 250
Target Start/End: Original strand, 5504071 - 5504139
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||    
5504071 gtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaag 5504139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 215
Target Start/End: Complemental strand, 48798197 - 48798105
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtc 215  Q
    ||||| ||||||||||||||||| ||| ||||||| ||||||| ||||||| ||| |  ||||||||||||||||||||||||||||||||||    
48798197 tccaatgacgtatccggggaatatcgggttcgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccggattagtc 48798105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 166 - 250
Target Start/End: Complemental strand, 50371918 - 50371834
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| |||||| || ||||||| ||||||||  |||||||||||||||||| ||||||||| |||||||||||||||||||    
50371918 gaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag 50371834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 2567257 - 2567384
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||| ||| ||||||||| |||||||  | ||| || ||||| |||||| |||||||||||||||| || ||| | |||||| || ||| |    
2567257 tccaaggacgtattcggagaataccgggttcgattttcggggaaaacaacgcttggccagtgcgcatgcctctactcacgagtcagattagccgtccatc 2567356  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||||||||||| ||||||    
2567357 tttggtgggtcggaaaccggtacgaaag 2567384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 165 - 240
Target Start/End: Original strand, 10507721 - 10507796
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaacc 240  Q
    |||||||||||||||| ||| |||| |||||||||||||||||||||||||| |||||  ||||||||||||||||    
10507721 ggaacaacgtttggccagtgtgcatacctctacgcatgagccggattagtcgtccaccactggtgggtcggaaacc 10507796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 185 - 252
Target Start/End: Complemental strand, 35211237 - 35211170
Alignment:
185 cgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||| |||||||    
35211237 cgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaaagcc 35211170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 130 - 252
Target Start/End: Original strand, 17389759 - 17389881
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    ||||| |||||| |||| ||| |||||||  | ||||||||| ||||| || ||||||||||||| |||||||||| |||||||||| |||    || ||    
17389759 gacgtttccgggaaatatcggattcgattttcgggggaacaatgtttgaccagtgcgcatgcctccacgcatgagctggattagtcgtccattgctgatg 17389858  T
230 ggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||    
17389859 ggtcggaaaccggtgcgaaagcc 17389881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 26258677 - 26258803
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||| |||||| |||||||||||||| |||||||| ||||   |||||| |||| | |||| ||||||| |||||||||| ||||||| ||| ||||||    
26258677 tccaaagacgtacccggggaataccggattcgattctcaggaagacaacgcttggtcagtgcacatgcctttacgcatgagtcggattaatcgtccacct 26258776  T
224 ttggtgggtcggaaaccggtgcgaaag 250  Q
    || |||||| |||||| ||||| ||||    
26258777 ttagtgggttggaaactggtgcaaaag 26258803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 6899598 - 6899667
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| ||||||  |||||||||||||||||||||||| ||| ||||||||||||||||||||    
6899598 gtgcgcatgcctttacgcacaagccggattagtcgcccacctttgatggatcggaaaccggtgcgaaagc 6899667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 9853404 - 9853275
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| ||||  |||||||| ||||||||| ||||||| ||||||||  || |||||||||||||||| || || || ||||| ||| |||||    
9853404 tccaaggatgtacccggaaaataccgggttcgattcctaggggaaacaacgttttaccagtgcgcatgcctctacacacgaaccagattaatcgtccacc 9853305  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| |||| |||||| ||||||    
9853304 tttggtgggtcagaaatcggtgcaaaagcc 9853275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 13265922 - 13266019
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||| |||||||| | ||||||||| |||| || |||||| | ||| ||||||||||||||||||||||||||| ||||||| ||||||    
13265922 aaggacgtatccgaggaatacctggttcgattcctagggaaaacaacgtctagccagtgcgcatgcctctacgcatgagccgggttagtcgtccacct 13266019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 130 - 243
Target Start/End: Original strand, 25165388 - 25165501
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtg 229  Q
    |||||| | |||||||||||| |||||||  ||||||||||||  |  ||| ||||||||||||||| |||  ||||||||||||| | |||||||||||    
25165388 gacgtacctggggaataccggattcgattatcaggggaacaacactctgccagtgcgcatgcctctaggcacaagccggattagtcactcacctttggtg 25165487  T
230 ggtcggaaaccggt 243  Q
    |||||| |||||||    
25165488 ggtcggtaaccggt 25165501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 5063970 - 5063866
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||||| ||||||||  || ||||||||  ||||| |||||| |||||| ||||| ||| ||||| ||| |||| |||||||||||||||||    
5063970 tccaaggacgtatctggggaatattggattcgattcttaggggcacaacgcttggccagtgcgtatgtctctatgcacgagctggattagtcgcccacct 5063871  T
224 ttggt 228  Q
    |||||    
5063870 ttggt 5063866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 15238233 - 15238105
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |  ||||||| ||| ||||||||||||||| | ||||| ||||||  || ||||||||||||||| ||  |  ||||||||| ||||    
15238233 tccaaggacgtacctagggaatatcgggttcgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcatattagtcgctcacc 15238134  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||| |||||||||| |||||||    
15238133 tttggtgggttggaaaccggttcgaaagc 15238105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 31576671 - 31576547
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||||| |  |||||||| |||||||| |||||||| ||| | ||||||  ||||  |||||||||||||||||||| ||||||| ||| ||||    
31576671 aaggacgtatcccgaaaataccgggttcgattctcaggggaaacaatgcttggccaatgcgtgtgcctctacgcatgagccggcttagtcgtccatcttt 31576572  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
    | || ||||||||||||||| ||||    
31576571 gatgtgtcggaaaccggtgcaaaag 31576547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 129 - 247
Target Start/End: Complemental strand, 17092599 - 17092480
Alignment:
129 ggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttgg 227  Q
    |||||||| |||| |||| ||  |||||||  |||||||| ||||| |||||| ||| | ||||||||||||| ||||||||||||||| ||||||||||    
17092599 ggacgtattcgggaaatatcgagttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcgtccacctttgg 17092500  T
228 tgggtcggaaaccggtgcga 247  Q
    | | || |||||||||||||    
17092499 tagatcagaaaccggtgcga 17092480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 35908798 - 35908866
Alignment:
182 gtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||||| ||||||    
35908798 gtgcgcatgcctctacgcatgagccggattagtcgtccaccat--gtgggtcggaaaccggtgcaaaagcc 35908866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 126 - 251
Target Start/End: Complemental strand, 17358596 - 17358470
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||  |||||||||||| |||||||| ||||| |||||||| ||| ||  ||||||||||| |||||||||||| ||||||| |  || |||    
17358596 caaggacgtatttggggaataccgggttcgattctcagggagaacaacgcttgaccaatgcgcatgcctttacgcatgagcccgattagttgttcatctt 17358497  T
225 tggtgggtcggaaaccggtgcgaaagc 251  Q
    | ||||||| ||||||| | |||||||    
17358496 tagtgggtcagaaaccgctacgaaagc 17358470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 51437512 - 51437566
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
51437512 cgcatgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaaagc 51437566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 251
Target Start/End: Complemental strand, 12036831 - 12036742
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg-aaaccggtgcgaaagc 251  Q
    ||||||||| | |||||| ||||||||||||||||||| ||||| ||||| ||| ||||||||||||| |||| ||||| ||||||||||    
12036831 ggggaacaatgcttggccagtgcgcatgcctctacgcacgagccagattaatcgtccacctttggtggatcggaaaaccagtgcgaaagc 12036742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 12744650 - 12744521
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| | |||||| | | |||||||  |||||| ||||||| ||| |  ||||||||| |||||||||||||||| ||||||||| |||     
12744650 tccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcact 12744551  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||| ||||| | ||||||||||    
12744550 gttggtgggtcagaaacagatgcgaaagcc 12744521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 12755640 - 12755511
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| | |||||| | | |||||||  |||||| ||||||| ||| |  ||||||||| |||||||||||||||| ||||||||| |||     
12755640 tccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcact 12755541  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
     |||||||||| ||||| | ||||||||||    
12755540 gttggtgggtcagaaacagatgcgaaagcc 12755511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 124 - 192
Target Start/End: Complemental strand, 34334422 - 34334353
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcc 192  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||||||||  |||||| |||||||||||    
34334422 tccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcc 34334353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 141 - 252
Target Start/End: Complemental strand, 18708650 - 18708538
Alignment:
141 ggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 239  Q
    ||||||| || ||||||| ||||||||| ||| | |||||  |||||||||||||||| |||||||| |||||||||| |||||||| ||||| | ||||    
18708650 ggaatactgggttcgatttccaggggaagcaatgcttggctagtgcgcatgcctctacacatgagccagattagtcgctcacctttgatgggttgaaaac 18708551  T
240 cggtgcgaaagcc 252  Q
    || ||| ||||||    
18708550 cgatgctaaagcc 18708538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 252
Target Start/End: Complemental strand, 3850799 - 3850740
Alignment:
193 tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| ||| ||||||||||||||||||||  |||||||||||||||||||||||||    
3850799 tctacgcacgaggcggattagtcgcccacctttaatgggtcggaaaccggtgcgaaagcc 3850740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 14357780 - 14357863
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||| || ||||||||||||||||||| || |||||||| |||   ||| ||| |||||||||||||||||||||||    
14357780 aacaacgtttgaccagtgcgcatgcctctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaag 14357863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 19195391 - 19195469
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| ||||||||||||||||||||||||||      ||| ||||||||| || ||||||||||||||||||||    
19195391 aacaacgtttggccagtgcgcatgcctctacgcatgagccg-----atcgtccacctttgatgagtcggaaaccggtgcgaaag 19195469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 46929864 - 46929737
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||| |||||||| || ||||| ||  ||||||| |||   |||||||| ||||||  |||||||||||| || |||||||||||||||||| |||| |    
46929864 tccaaagacgtatctggagaatatcgagttcgatttccaaaagaacaacgcttggccaatgcgcatgcctccacacatgagccggattagtcgtccactt 46929765  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||| ||| ||| |||||| |||||||||    
46929764 ttgatggatcgaaaaccgatgcgaaagc 46929737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 245
Target Start/End: Complemental strand, 38859215 - 38859121
Alignment:
152 ttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 245  Q
    ||||||||||||||| ||||| |||||| |  ||| |||||||||||||| ||| | ||||| ||||||||||||| ||||||| ||||||||||    
38859215 ttcgattcccaggggtaacaatgtttggtcaatgcacatgcctctacgcacgagtcagattaatcgcccacctttgatgggtcgaaaaccggtgc 38859121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 215
Target Start/End: Complemental strand, 28324704 - 28324615
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaa-caacgtttggcccgtgcgcatgcctctacgcatgagccggattagtc 215  Q
    ||||||||| |  ||||||| ||| |||||||||| |||||| ||||  |||| | ||||||||||||||||||||||||||||||||||    
28324704 aaggacgtacctagggaatatcgggttcgattccccggggaaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtc 28324615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 165 - 238
Target Start/End: Original strand, 48761199 - 48761272
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    |||||||||||||| | |||  |||||||||||||| |||| |||||||||| ||||||||||| |||||||||    
48761199 ggaacaacgtttggtcagtggacatgcctctacgcacgagctggattagtcgtccacctttggtcggtcggaaa 48761272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 13262064 - 13262192
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||||  |||||||||||| ||||||| |||||| ||||||||||||| |  | |||||| ||||||||| ||| ||||||||||| |||||    
13262064 tccaaggatgtatatggggaataccgggttcgatttccagggagaacaacgtttggtcaatacgcatgtctctacgcacgagtcggattagtcgtccacc 13262163  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
     |||  || ||| |||||| |||| ||||    
13262164 attgaaggatcgaaaaccgatgcggaagc 13262192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 18808246 - 18808374
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||   |||||| | | ||| |||| ||| |||||||||| ||| || |||||||||||| || | ||||||||||||| ||| | | |    
18808246 tccaaggacgtatctaaggaataacaggttcaattctcagagggaacaacgcttgaccagtgcgcatgcctttatgtatgagccggattattcgactaac 18808345  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||  ||||||||||||||||||||||||    
18808346 tttattgggtcggaaaccggtgcgaaagc 18808374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 211
Target Start/End: Original strand, 34877971 - 34878059
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggatt 211  Q
    ||||||||||||| ||||||||||| | ||||||||| ||| ||||||||  |||||| |||||||||||||||| || ||||| ||||    
34877971 tccaaggacgtattcggggaataccaggttcgattcctaggcggaacaacacttggccagtgcgcatgcctctacacacgagccagatt 34878059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 47084231 - 47084175
Alignment:
195 tacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||||||||||| | ||||| |||||||||| ||||||||||||||||||    
47084231 tacgcatgagccggattagccacccacttttggtgggttggaaaccggtgcgaaagc 47084175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 126 - 252
Target Start/End: Original strand, 28416929 - 28417056
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctt 224  Q
    |||||||||||  ||| |||||||| || ||||| ||| ||||||||||||||||| | |||||||| |||||||| || || ||||||| || |||  |    
28416929 caaggacgtatatgggaaataccggatttgattctcagagggaacaacgtttggccagggcgcatgcatctacgcacgaacccgattagttgctcactat 28417028  T
225 tggtgggtcggaaaccggtgcgaaagcc 252  Q
    || ||| ||| ||||||||| |||||||    
28417029 tgatggatcgaaaaccggtgtgaaagcc 28417056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 251
Target Start/End: Original strand, 42744801 - 42744881
Alignment:
165 ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||| |||||| ||| ||||||||||||||| ||||||      |||||||||||| |||| ||||||||||||||||||||    
42744801 ggaacaacgcttggccagtgagcatgcctctacgcacgagccg------tcgcccacctttagtggatcggaaaccggtgcgaaagc 42744881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 194 - 252
Target Start/End: Complemental strand, 1764253 - 1764195
Alignment:
194 ctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||||| ||||||||||||||||||||| | |||||||||| | ||||||||||    
1764253 ctacgcatgaggcggattagtcgcccacctttgataggtcggaaactgatgcgaaagcc 1764195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 216
Target Start/End: Complemental strand, 17988783 - 17988694
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcg 216  Q
    ||||||||| || ||||||||| | || ||||  ||||| ||||| | |||||| |||||||| ||||||||||||| ||||||||||||    
17988783 aaggacgtaccccgggaataccaggtttgattttcagggaaacaatgcttggccagtgcgcatacctctacgcatgaaccggattagtcg 17988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 25178699 - 25178574
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||||||  ||| |||||||  ||| ||||| | ||||| |||| |||||| |||||||| |||||||  |  ||||||||||||||  |||||||     
25178699 aaggacgtatttgggaaataccgagttctattcctaagggaataacgcttggccagtgcgcatacctctacagacaagccggattagtcgttcaccttta 25178600  T
227 gtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||| |||||| | ||||||||    
25178599 gtgggtcgaaaaccgatacgaaagcc 25178574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 31152697 - 31152825
Alignment:
124 tccaaggacgtatccggggaataccggtttcgatt-cccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||| || ||||||||||| ||||||| ||| |||||| |||| |||| | |||||| ||||||||| || ||| |  |||||||| |||||    
31152697 tccaaggatgtacccagggaataccgggttcgatttcccgggggaataacgcttggtcagtgcgcgtgcctctacacacgagtcaaattagtcgtccacc 31152796  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||| || ||| | |||||||||||||    
31152797 tttggtgagttggaga-cggtgcgaaagcc 31152825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 250
Target Start/End: Original strand, 45536769 - 45536830
Alignment:
189 tgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||||   |||||||||||||||||||  || |||||||||||||||||||||||    
45536769 tgcctctacgcacttgccggattagtcgcccaccaatgatgggtcggaaaccggtgcgaaag 45536830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 124 - 204
Target Start/End: Complemental strand, 2270379 - 2270301
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgag 204  Q
    |||||||||||||| ||| | |||||| ||||||||| |||||||||| |||||| | |||||||| ||||||||||||||    
2270379 tccaaggacgtatc-gggaattaccggattcgattcc-aggggaacaatgtttggtctgtgcgcatacctctacgcatgag 2270301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 164 - 252
Target Start/End: Complemental strand, 5143239 - 5143152
Alignment:
164 gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||| |||| | || ||||||||||||||||  || |||||||||||| |||||||| ||| ||| ||||||||| |||||||    
5143239 gggaacaacgcttggtcagtacgcatgcctctacgcac-agacggattagtcgctcacctttgatggatcgaaaaccggtgtgaaagcc 5143152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 34878626 - 34878674
Alignment:
202 gagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||| |||||||||| ||||||||||| |||||||||||    
34878626 gagccggattagtcacccacctttgatgggtcggaaatcggtgcgaaag 34878674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 167 - 226
Target Start/End: Complemental strand, 38791693 - 38791634
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttg 226  Q
    ||||||| |||||  |||||||||||||||||||||||||| |||||||| ||| |||||    
38791693 aacaacgattggcaagtgcgcatgcctctacgcatgagccgaattagtcgtccatctttg 38791634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 251
Target Start/End: Original strand, 40702585 - 40702623
Alignment:
213 gtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||| ||||||||||||||||||||||||    
40702585 gtcgcccacctttgatgggtcggaaaccggtgcgaaagc 40702623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 42710213 - 42710147
Alignment:
175 ttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 241  Q
    |||||| |||||||||||||||||||| | ||| |||||||| ||||| ||||| | ||||||||||    
42710213 ttggccagtgcgcatgcctctacgcataaaccgaattagtcgtccaccattggtagatcggaaaccg 42710147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 197 - 250
Target Start/End: Complemental strand, 8905216 - 8905163
Alignment:
197 cgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||| ||||| ||| ||||||||| | |||||||||||||||||||||    
8905216 cgcatgagccagattaatcgaccacctttgattggtcggaaaccggtgcgaaag 8905163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 200
Target Start/End: Original strand, 45536689 - 45536766
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgca 200  Q
    ||||| |||||| |||| ||||||||| ||||||| | | ||||||||||| |||||| |||| ||||||||||||||    
45536689 tccaatgacgtacccggagaataccgggttcgatttctaaggggaacaacgcttggccagtgcacatgcctctacgca 45536766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 41743254 - 41743302
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaac 172  Q
    |||||||||||||||| |||||||||| |||||||||||| | ||||||    
41743254 tccaaggacgtatccgaggaataccgggttcgattcccagagaaacaac 41743302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 214
Target Start/End: Original strand, 6563422 - 6563513
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagt 214  Q
    |||||||| ||| |||  ||| ||||| ||||||||| ||||| ||||||| |||||| |||| |||| ||||||||| ||||| |||||||    
6563422 tccaaggatgtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgcacgagccagattagt 6563513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 190
Target Start/End: Complemental strand, 8905277 - 8905211
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatg 190  Q
    ||||| ||||||||||| ||||| ||| | ||||| | |||||||||||| |||||| |||||||||    
8905277 tccaatgacgtatccggagaatatcgggtacgatttcaaggggaacaacgcttggccagtgcgcatg 8905211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 198
Target Start/End: Original strand, 31734270 - 31734344
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacg 198  Q
    |||||||| ||| ||| ||||||| || ||||||||   ||| ||||||| |||||| |||||||||||||||||    
31734270 tccaaggatgtacccgaggaatactggattcgattctaggggaaacaacgattggccagtgcgcatgcctctacg 31734344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 41696724 - 41696596
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaac-aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| | ||||||| |||| ||||| ||||||| |  |||  ||| || ||| | ||||||||||||| ||  | |||||||||| ||||    
41696724 tccaaggacgtatctgaggaatacgggtt-cgatttccagggggattaacacttgaccagtgtgtatgcctctacgcacgaatcagattagtcgctcacc 41696626  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||| ||| |||||||| | ||||||||||    
41696625 tttgatggatcggaaactgatgcgaaagcc 41696596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 44716299 - 44716231
Alignment:
166 gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcg 234  Q
    |||||||||||| |  |||||||||||| || ||||||| | ||||||||| |||  ||||||||||||    
44716299 gaacaacgtttgactagtgcgcatgcctttatgcatgagtcagattagtcgtccatttttggtgggtcg 44716231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 250
Target Start/End: Original strand, 50952261 - 50952341
Alignment:
170 aacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| |||||| ||| ||||||||||||||| ||| |  ||||||| |||||||||| |||||  ||||| || |||||||    
50952261 aacgattggccagtgtgcatgcctctacgcacgagacaaattagtcacccacctttgatgggttagaaactggcgcgaaag 50952341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 173
Target Start/End: Original strand, 51437452 - 51437500
Alignment:
126 caaggacgtatccggggaataccggtttcgattccca-ggggaacaacg 173  Q
    |||||||||||||| |||||| ||| ||||||||||| |||||||||||    
51437452 caaggacgtatccgaggaatatcgggttcgattcccatggggaacaacg 51437500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 137 - 251
Target Start/End: Original strand, 6851 - 6966
Alignment:
137 ccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcgg 235  Q
    |||||||||||||| ||||||||||||||| ||||||  |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6851 ccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcgg 6950  T
236 aaaccggtgcgaaagc 251  Q
    ||||||||||||||||    
6951 aaaccggtgcgaaagc 6966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 130 - 251
Target Start/End: Complemental strand, 8821 - 8699
Alignment:
130 gacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||||||| | |||||||||| ||||||||||||||| ||||||| |||||| |||||| ||||||||||||||||| |||||||||| |||||||||||    
8821 gacgtatcagaggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggt 8722  T
229 gggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| |||||||||||    
8721 gggtcggaaactggtgcgaaagc 8699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 123 - 252
Target Start/End: Complemental strand, 7962 - 7832
Alignment:
123 gtccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccac 221  Q
    ||||||||||||| |||||||||||||| || |||||||| |||||| |||  |||||| |||||||||||||||||||| ||| |||||||||||||||    
7962 gtccaaggacgtacccggggaataccgggtttgattcccaaggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccac 7863  T
222 ctttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| |||||||||||| ||||||||    
7862 ctttggtggatcggaaaccggtacgaaagcc 7832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 124 - 252
Target Start/End: Complemental strand, 95105 - 94977
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc- 222  Q
    |||||| | |||||||||||||||| | ||||||| | |||  ||||||||||| || |||||||||||| ||||||||||||||||||||||||||||     
95105 tccaagaaagtatccggggaataccaggttcgatttctagga-aacaacgtttgaccagtgcgcatgcctttacgcatgagccggattagtcgcccacca 95007  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||| |||||| ||||||    
95006 tttggtgggtcggaaatcggtgcaaaagcc 94977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 78; Significance: 3e-36; HSPs: 3)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 319405 - 319534
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    ||||||||||||||||||||||||||| || |||| | ||||| ||||||| |||||| |||||||| |||||| |||||||| |||||||||| |||||    
319405 tccaaggacgtatccggggaataccgggtttgatttctagggggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacc 319504  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||||||||| ||||||||||||||||||||    
319505 tttggtggggcggaaaccggtgcgaaagcc 319534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 553 - 681
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| |||||||||||||| |||||||| |||||| ||||||  |||  | ||| ||||||||||||| ||||||| |||||||||| ||||    
553 tccaaggacgtacccggggaataccgggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacc 652  T
223 tttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||||||||||||||||||||    
653 tttggtgggtcggaaaccggtgcgaaagc 681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 412152 - 412097
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttgg 178  Q
    ||||||||||||||||||||||||||  |||||||| || ||||||||||| ||||    
412152 tccaaggacgtatccggggaataccgagttcgattcacagggggaacaacgcttgg 412097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 150 - 252
Target Start/End: Complemental strand, 155811 - 155708
Alignment:
150 gtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 248  Q
    ||||||||||||||||| ||||||| |||||  ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||    
155811 gtttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaa 155712  T
249 agcc 252  Q
    ||||    
155711 agcc 155708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 25910 - 25784
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||| |||||  ||||||||||  | ||||||||| |||| |||||||| |||||| ||||||||| |||||||| ||| || |||||||| ||||||    
25910 tccaagtacgtactcggggaatacaaggttcgattcctagggagaacaacgcttggccagtgcgcatgactctacgcgtgaaccagattagtcacccacc 25811  T
223 tttggtgggtcggaaaccggtgcgaaa 249  Q
    |||  |||||| |||||||||||||||    
25810 tttactgggtcagaaaccggtgcgaaa 25784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 68500 - 68626
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||| ||||| |||| ||| ||||||||||||||| ||||||| ||||   ||||||||||||||||||| |||||||||||||||||||||    
68500 tccaaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacc 68596  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||| |||||||||||| ||||    
68597 tttggtgggtcgaaaaccggtgcgatagcc 68626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 250
Target Start/End: Complemental strand, 42943 - 42831
Alignment:
139 ggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    |||||||| ||| ||||||||| |||| |||||| | |||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
42943 ggggaatatcgggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaa 42844  T
238 accggtgcgaaag 250  Q
    |||||||||||||    
42843 accggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 126 - 249
Target Start/End: Original strand, 9421 - 9551
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctcta-------cgcatgagccggattagtcgc 217  Q
    ||||||||||   |||||||||||| ||||||||||||||| ||||||| |||||| ||  | |||||||||       ||||||||||  ||||||||     
9421 caaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttggccagtaag-atgcctctaagttctacgcatgagccaaattagtcgt 9519  T
218 ccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||||||||||||| |||||||||||||||    
9520 ccacctttggtgggtcagaaaccggtgcgaaa 9551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 12653 - 12780
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagg-ggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||  |||||||||||||| ||||||||  ||| ||||||||| |||||| ||| ||||||||||||||| || ||||||||||||||||||    
12653 tccaaggacgtgcccggggaataccgggttcgattcagaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacc 12752  T
223 tttggtgggtcggaaaccggtgcgaaag 250  Q
    |||| |||||| ||||||||||||||||    
12753 tttgatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 1725 - 1612
Alignment:
139 ggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    |||||||||| | ||||||| ||||||| ||||||| || ||| |||||||||||||||||||||||||  |||||||||||||||||||||||||| ||    
1725 ggggaataccaggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaa 1626  T
238 accggtgcgaaagc 251  Q
    ||||||||||||||    
1625 accggtgcgaaagc 1612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 124 - 240
Target Start/End: Original strand, 9828 - 9945
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||| ||||| | |||||||||| ||||||| ||||||| ||||||| |||||| ||||||||||||||||||| ||||||||||||||| |||||    
9828 tccaaggatgtatctgaggaataccggattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacc 9927  T
223 tttggtgggtcggaaacc 240  Q
    ||||||||||| ||||||    
9928 tttggtgggtcagaaacc 9945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 12558 - 12685
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    ||||||||||||  || | |||||||| ||||||||| |||| ||||||| ||| || ||||||||||||||||||||||| ||||||||||||||||||    
12558 tccaaggacgtactcgagaaataccgggttcgattcctaggg-aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacct 12656  T
224 ttggtgggtcggaaaccggtgcgaaagcc 252  Q
    ||| ||| |  ||||||||||||||||||    
12657 ttgatggattagaaaccggtgcgaaagcc 12685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 126 - 241
Target Start/End: Original strand, 5958 - 6073
Alignment:
126 caaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||| |||| ||||||||||| || ||||||| ||||||| |||||| |||||| |||| |||||||||||||||||| || |||||||| ||||| ||    
5958 caagggcgtacccggggaatactgggttcgatttccagggggacaacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccatt 6057  T
226 ggtgggtcggaaaccg 241  Q
    ||||||||||||||||    
6058 ggtgggtcggaaaccg 6073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 8158 - 8274
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccaggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacct 223  Q
    |||||||||||| |||||||||||||| ||||||||||| |||||||||| |||||| ||||||||||||||||           |||||||| ||||||    
8158 tccaaggacgtacccggggaataccgggttcgattcccaagggaacaacgcttggccagtgcgcatgcctctac-----------attagtcgtccacct 8246  T
224 ttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||| ||||||||||||||||||||||    
8247 ttggtaggtcggaaaccggtgcgaaagc 8274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 252
Target Start/End: Original strand, 41043 - 41156
Alignment:
140 gggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaa 238  Q
    ||||||| ||| |||||||| || ||||||||||  |||| | ||| ||||||||||||||| ||||||||||||||||||| |||||||| ||||||||    
41043 gggaatatcgggttcgattctcaaggggaacaacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgcccatctttggtgagtcggaaa 41142  T
239 ccggtgcgaaagcc 252  Q
    ||||| ||||||||    
41143 ccggttcgaaagcc 41156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 58; Significance: 2e-24; HSPs: 4)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 173 - 250
Target Start/End: Complemental strand, 250101 - 250024
Alignment:
173 gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||| ||||||||||||||||||| |||||||||||||||| | |||||||||||||||||| |||||||||||    
250101 gtttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 250024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 271200 - 271103
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgccca 220  Q
    |||||||||||| |||| ||||| ||| ||||||||||||||| ||||||| |||| | ||||||||| ||||||||| ||||||| |||||||||||    
271200 tccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgcacgagccgggttagtcgccca 271103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 173 - 251
Target Start/End: Original strand, 219402 - 219480
Alignment:
173 gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| ||||||||||||||||||| || | |||||||||| ||||||||| ||| ||| |||||||||| |||||    
219402 gtttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 219480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 249428 - 249308
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    ||||||||||  |||||||||| | |||||||| ||||| ||| |||| ||| || |||| ||| |||||||||| ||| ||||||||||||      |     
249428 aaggacgtatttggggaataccaggttcgattctcagggagaataacgcttgaccagtgcacatacctctacgcacgagtcggattagtcgc------tg 249335  T
226 ggtgggtcggaaaccggtgcgaaagcc 252  Q
    |||||||||||||||||||||||||||    
249334 ggtgggtcggaaaccggtgcgaaagcc 249308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 224303 - 224427
Alignment:
127 aaggacgtatccggggaataccggtttcgattcccaggg-gaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 225  Q
    |||||||||| ||| ||||| ||| ||||| || ||||| ||| ||||||||  | |||| ||| |||||||||| ||||||||||||||| ||| ||||    
224303 aaggacgtattcggagaatatcgggttcgaatctcagggagaataacgtttgatcagtgcacatacctctacgcacgagccggattagtcgtccatcttt 224402  T
226 ggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||||||||||||||||    
224403 ggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 173 - 249
Target Start/End: Original strand, 186550 - 186626
Alignment:
173 gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    |||||| | |||| |||||||||||||| |||||||||||||||  || |||| |||||||||||||||||| ||||    
186550 gtttggtcagtgcacatgcctctacgcacgagccggattagtcgttcatctttagtgggtcggaaaccggtgtgaaa 186626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 162 - 251
Target Start/End: Complemental strand, 65239 - 65150
Alignment:
162 aggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||||||| |||||| ||||||||| |||||||||||||| ||||||||||| ||| |||| | | ||||||||||||||||||||    
65239 aggggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaagc 65150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 139 - 250
Target Start/End: Original strand, 26181 - 26293
Alignment:
139 ggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaa 237  Q
    ||||||||| || ||||||| ||||||| ||||||| |||||| ||| ||||||||||||||| ||||||||||||||| ||||  ||| || |||||||    
26181 ggggaatactgggttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaa 26280  T
238 accggtgcgaaag 250  Q
    ||| |||||||||    
26281 accagtgcgaaag 26293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 72616 - 72744
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattccca-ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacc 222  Q
    |||||||||||||| ||| |||||||| ||||||| ||| ||||||||||| ||| || ||||||||||||| | |||| |||||||||||||||| | |    
72616 tccaaggacgtatcaggg-aataccgggttcgatttccaaggggaacaacgcttgaccagtgcgcatgcctcaaagcataagccggattagtcgcctatc 72714  T
223 tttggtgggtcggaaaccggtgcgaaagcc 252  Q
       ||||| || ||||||||| ||||||||    
72715 aagggtggatctgaaaccggtacgaaagcc 72744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 72802 - 72866
Alignment:
187 catgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    |||||||| ||||||||||||||||||||||| |||   ||||||||| |||||||||| |||||    
72802 catgcctcaacgcatgagccggattagtcgcctaccacaggtgggtcgaaaaccggtgcaaaagc 72866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 250
Target Start/End: Original strand, 25106 - 25195
Alignment:
161 caggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    |||||||||||| ||||| | |||||||||  |||||||||||  | ||||| ||| ||||||||||||| |||||||||||||||||||    
25106 caggggaacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag 25195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 16906 - 16989
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||| |||| | ||||| ||| ||||||||| ||||| |||||||||| |||||||||||||| |||||||| ||||||||    
16906 aacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0155 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 249
Target Start/End: Original strand, 19278 - 19364
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 249  Q
    ||||||||||| |||||  |||||||  |||||||||||||||||||||||||| |||   || |||| ||||||||||||||||||    
19278 ggggaacaacgcttggctagtgcgcagacctctacgcatgagccggattagtcggccattattagtggatcggaaaccggtgcgaaa 19364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 145 - 250
Target Start/End: Original strand, 51735 - 51837
Alignment:
145 taccggtttcgattcccag-gggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggt 243  Q
    |||||| |||||||||||| |||||||||| |||||| ||||||||| ||    ||| ||||||||| ||||||||||||||| ||| || |||||||||    
51735 taccgggttcgattcccagagggaacaacgcttggccagtgcgcatgtct----gcacgagccggatcagtcgcccacctttgatggatctgaaaccggt 51830  T
244 gcgaaag 250  Q
    | |||||    
51831 gtgaaag 51837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 130 - 241
Target Start/End: Original strand, 17379 - 17491
Alignment:
130 gacgtatccggggaataccggtttcgattcccaggggaacaac-gtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 228  Q
    |||| ||||| ||| || ||| |||||||| |||||||| ||  | ||| || |||||||||| ||||| || ||||||||||||||||||||| ||| |    
17379 gacggatccgaggattatcggattcgattctcaggggaaaaaatgcttgaccagtgcgcatgcttctacacacgagccggattagtcgcccaccattgat 17478  T
229 gggtcggaaaccg 241  Q
    |||||||||||||    
17479 gggtcggaaaccg 17491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 250
Target Start/End: Complemental strand, 58115 - 58032
Alignment:
167 aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 250  Q
    ||||||||||| || ||| | || ||||||||||||||  |||||||||||| | ||||||||| ||||| |||||||||||||    
58115 aacaacgtttgaccagtgtgtatacctctacgcatgagttggattagtcgcctatctttggtggatcggataccggtgcgaaag 58032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 251
Target Start/End: Original strand, 149408 - 149496
Alignment:
163 ggggaacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 251  Q
    ||||||||||| ||| || ||| ||||||||||||| | |||   |||||||||||||||  ||||||||| ||||||||||| |||||    
149408 ggggaacaacgcttgaccagtgtgcatgcctctacgtacgaggtagattagtcgcccaccaatggtgggtcagaaaccggtgcaaaagc 149496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 214
Target Start/End: Original strand, 18615 - 18706
Alignment:
124 tccaaggacgtatccggggaataccggtttcgattcccagggg-aacaacgtttggcccgtgcgcatgcctctacgcatgagccggattagt 214  Q
    |||||||| ||| |||  ||| ||||| ||||||||| ||||| ||||||| |||||| |||| |||| ||||||||| ||||| |||||||    
18615 tccaaggatgtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgcacgagccagattagt 18706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University