View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_29 (Length: 305)
Name: NF19239_low_29
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22922070 - 22922023
Alignment:
| Q |
1 |
atcactctttgtacgataaaagtatgtggaataatatttggtatcttg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22922070 |
atcactctttgtacgataaaagtatgtgcaataatatttggtatcttg |
22922023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University