View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_31 (Length: 280)
Name: NF19239_low_31
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 47658064 - 47658310
Alignment:
| Q |
17 |
tgtggagaatatcagaaggtttgaaaaggggtgttaacaaggttcatgacgacgttgtagacaaaggaatgcaagttgttagatatgtaggagctaagtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47658064 |
tgtggagaatatcagaaggtttgaaaaggggtgttaacaaggttcatgacgacgttgtagacaaaggaatgcaagttgttagatatgtaggagctaagtc |
47658163 |
T |
 |
| Q |
117 |
gtcggttattattaccttgtgtcttgctttatatttacatattttgggtggtagtaggattctagtggctgcttagcatgatcattcatcctaccctcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47658164 |
gtcggttattattaccttgtgtcttgctttatatttacatattttgggtggtagtaggattctagtggctgcttagcatgatcattcatcctaccctcat |
47658263 |
T |
 |
| Q |
217 |
acttgtaatgcagttggaatataatttgcagctagatttgatcttta |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47658264 |
acttgtaatgcagttggaatataatttgcagctagatttgatcttta |
47658310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University