View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_34 (Length: 261)
Name: NF19239_low_34
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 5 - 246
Target Start/End: Original strand, 232515 - 232756
Alignment:
| Q |
5 |
tattctcttaaacattgattgaatgatgaaatgcaaaagtccctttaccgtaaaaagaaagtttcaatcaacagttattagatagacagatatgtaaatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232515 |
tattctcttaaacattgattgaatgatgaaatgcaaaagtccctttaccgtaaaaagaaagtttcaatcaacagttattagatagacagatatgtaaatt |
232614 |
T |
 |
| Q |
105 |
gtattttcgaaataaattgcatatccctcactttacaaaagttaagttataccagttgcttttatcatacatgtaagttagcctattctttcactaatta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232615 |
gtattttcgaaataaattgcatatccctcactttacaaaagttaagttataccagttgcttttatcatacatgtaagttagcctattctttcactaatta |
232714 |
T |
 |
| Q |
205 |
gacatttcaccctcttaattagcaccgtcatcagcagtttgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232715 |
gacatttcaccctcttaattagcaccgtcatcagcagtttgt |
232756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University