View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19239_low_42 (Length: 236)
Name: NF19239_low_42
Description: NF19239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19239_low_42 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 3845004 - 3844769
Alignment:
| Q |
1 |
ttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaaatagtgaattgcacttctttcaatgtatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845004 |
ttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaaatagtgaattgcacttctttcaatgtatctt |
3844905 |
T |
|
| Q |
101 |
atcagtattcactattcactgtgtattatttatgggtaggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatggaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3844904 |
atcagcattcactattcactgtgtattatttatgggtaggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatggaa |
3844805 |
T |
|
| Q |
201 |
gaagcataccaaggcaagctctacttttacattttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3844804 |
gaagcataccaaggcaagctctacttttacattttc |
3844769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 138 - 217
Target Start/End: Complemental strand, 2882102 - 2882023
Alignment:
| Q |
138 |
aggctctgattcagtacactgatgctgagactgctgcttcggctaaggattcactcgatggaagaagcataccaaggcaa |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |||| | || |||||||||||||||||||||||| |
|
|
| T |
2882102 |
aggctctgattcagttcactgatgctgagactgctgcttcagctagggatgccctggatggaagaagcataccaaggcaa |
2882023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 2882245 - 2882177
Alignment:
| Q |
1 |
ttttctgcgtttggctttgtacacaaacttgccacatttgaaaagactgcaggttttcaggttagtgaa |
69 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||| ||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
2882245 |
ttttctgcttttggctttgttcacaaaattgctacattcgaaaagaccgcaggtttccaggttagtgaa |
2882177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University