View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1923_high_6 (Length: 250)
Name: NF1923_high_6
Description: NF1923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1923_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 8882930 - 8882697
Alignment:
| Q |
1 |
tcttacatttgaacatttctatacaaaataattgtcaccattttagatatnnnnnnnnttagttttataaccatcatttgaactatggagcttattttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8882930 |
tcttacatttgaacatttctatacaaaataattgtcaccattttagatataaaaaaatttagttttataaccatcatttgaactatggagcttattttca |
8882831 |
T |
 |
| Q |
101 |
aattcttttaggtgtttcttcagttcaaccatttgaactatgtctttgggaactgtaagcatttgattattcttttgattgggcaaatattttgattgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8882830 |
aattcttttaggtgtttcttcagttcaaccatttgaactatgtctttgggacctgtaagcatttgattattcttttgattgggcaaatattttgattg-- |
8882733 |
T |
 |
| Q |
201 |
tatatggtcattgtattttcgtttcctgttagtgttct |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8882732 |
--tatggtcattgtatttttgtttcctgttagtgttct |
8882697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 6 - 117
Target Start/End: Complemental strand, 8879075 - 8878965
Alignment:
| Q |
6 |
catttgaacatttctatacaaaataattgtcaccattttagatatnnnnnnnnttagttttataaccatcatttgaactatggagcttattttcaaattc |
105 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| || | |||||||| ||||||||||||||||| || || |||||||||||| |
|
|
| T |
8879075 |
catttgagcatttatatacaaaataattgtcaccattttaaatttataaaatgttagttttgcaaccatcatttgaactacgg-cctcattttcaaattc |
8878977 |
T |
 |
| Q |
106 |
ttttaggtgttt |
117 |
Q |
| |
|
||||||| |||| |
|
|
| T |
8878976 |
ttttaggggttt |
8878965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University