View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1923_high_7 (Length: 249)
Name: NF1923_high_7
Description: NF1923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1923_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 17006020 - 17005794
Alignment:
| Q |
18 |
aatggctcttcatataaacagtggttgttttactgtgatgggtcactgtagagttcaaagagtaaaagctgttgcttcagagggttctgctaatgttaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006020 |
aatggctcttcatataaacagtggttgttttactgtgatgggtcactgtagagttcaaagagtaaaagctgttgcttcagagggttctgctaatgttaca |
17005921 |
T |
|
| Q |
118 |
gttgaagataagttgaaattgggtggttctgatttgaaggtgtcaactattggaattggagcttggtcttggggtgatactacttactggaacaattttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17005920 |
gttgaagataagttgaaattgggtggttctgatttgaaggtgtcaactattggaattggagcttggtcttggggtgatactacttactggaacaattttc |
17005821 |
T |
|
| Q |
218 |
aatggaatggtaacttttcttttctct |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17005820 |
aatggaatggtaacttttcttttctct |
17005794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University