View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1923_low_10 (Length: 279)
Name: NF1923_low_10
Description: NF1923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1923_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 268
Target Start/End: Original strand, 44968767 - 44969030
Alignment:
| Q |
4 |
tcccaatctcaatcacccgtagctattgatttatctaacgaagaatccaaaaggcgcttatttaacaggttctcctctttttaannnnnnnnnccccatt |
103 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44968767 |
tcccaatctcaatcacccgtagttattaatttatctaacgaagaatccaaaaggcgcttatttaacaggttctcctctttttaatttttttt-ccccatt |
44968865 |
T |
|
| Q |
104 |
ttgattgggcttaacgttctttatttgtttgatttctcaatgctccataggttattatatagaagcaaacaacgcgggtttctggaactggacttggttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44968866 |
ttgattgggcttaacgttctttatttgtttgatttctcaatgctccataggttattatatagaagcaaacaacgcgggtttctggaactggacttggttc |
44968965 |
T |
|
| Q |
204 |
ttggcaaatgggtagaggataatatccataaattggatgaaaatcggattaaagctctcattcat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44968966 |
ttggcaaatgggtagaggataatatccataaattggatgaaaatcggattaaagctctcattcat |
44969030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 231
Target Start/End: Original strand, 40071303 - 40071384
Alignment:
| Q |
150 |
ataggttattatatagaagcaaacaacgcgggtttctggaactggacttggttcttggcaaatgggtagaggataatatcca |
231 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||||||| ||||| || |||||||||| ||||||||| || | |||||||| |
|
|
| T |
40071303 |
ataggttattgtatagaagcaagcaacgagggtttctcgaactcgatctggttcttggaaaatgggtacagaacaatatcca |
40071384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University