View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_17 (Length: 343)
Name: NF19240_high_17
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 75 - 343
Target Start/End: Original strand, 37145220 - 37145489
Alignment:
| Q |
75 |
ctctgttattgggattaggtatagttagctatgattatatcataaactcttaatctggctggttatatataatctctattttgttatgttcatgatttat |
174 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
37145220 |
ctctgttattgggattaagtttagttagctatgattatattgtaaacttttaatctggctggttatatataatctctatatcgttatgttcatgatttat |
37145319 |
T |
 |
| Q |
175 |
ttttgtgcttaatgcttttccgatgcaaaactccgaaattgatatttagatttagaaagtgctagacatagcctttttacttaaaaggatgtgaaataaa |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37145320 |
ttttgtgcttaatgcttttccgatgcaaaactccgaaattgatatttagatttagaaagcgctaaacatagcctttttactt-aaaggatgtgaaataaa |
37145418 |
T |
 |
| Q |
275 |
ttcatccatggaacttaatagctag--acagtgttaatttcgtagtcataatactatcgggtcgtaatgcc |
343 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
37145419 |
ttcatccatggaacttaatagctagacacactgttaatttcgtagtcacaatactattgggtcgtactgcc |
37145489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 141 - 193
Target Start/End: Complemental strand, 21485 - 21433
Alignment:
| Q |
141 |
atataatctctattttgttatgttcatgatttatttttgtgcttaatgctttt |
193 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
21485 |
atataatctctattttgttattttgatgatttatttttgttcttaatgctttt |
21433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University