View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19240_high_25 (Length: 278)

Name: NF19240_high_25
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19240_high_25
NF19240_high_25
[»] chr2 (1 HSPs)
chr2 (12-137)||(37145468-37145593)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 12 - 137
Target Start/End: Original strand, 37145468 - 37145593
Alignment:
12 aatactatcgggtcgtaatgccattatattgattaatcgcttgagatatcgggggttaataggtataacaaaactcttgtctagctctggatacagaagc 111  Q
    |||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||  |||| |||||| |||||    
37145468 aatactattgggtcgtactgccattatattgattaatcgcttgagacatcgggggttaataggtataacaaaactcttgtcgtgctccggatacggaagc 37145567  T
112 gtatgtgagcgataggtgaaagcata 137  Q
    ||||||||||||||||||||||||||    
37145568 gtatgtgagcgataggtgaaagcata 37145593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University