View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_25 (Length: 278)
Name: NF19240_high_25
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 12 - 137
Target Start/End: Original strand, 37145468 - 37145593
Alignment:
| Q |
12 |
aatactatcgggtcgtaatgccattatattgattaatcgcttgagatatcgggggttaataggtataacaaaactcttgtctagctctggatacagaagc |
111 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
37145468 |
aatactattgggtcgtactgccattatattgattaatcgcttgagacatcgggggttaataggtataacaaaactcttgtcgtgctccggatacggaagc |
37145567 |
T |
 |
| Q |
112 |
gtatgtgagcgataggtgaaagcata |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37145568 |
gtatgtgagcgataggtgaaagcata |
37145593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University