View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_26 (Length: 276)
Name: NF19240_high_26
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 26739889 - 26739639
Alignment:
| Q |
17 |
gttaatggtggtcgtgacgaagtctagcgttcctatagaggtcgacggcaaagtctgatgactcatgatggtttggcagagatccaatgatccttttaat |
116 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26739889 |
gttaatggtggttgtgaggaagtctagcgttcctatagaggtcgacggcagagtccgatgactcatgatggtttggcagagatccaatgatccttttaat |
26739790 |
T |
|
| Q |
117 |
ggttggtagtagagctcatgtgatttgcagttgtcagcatagctgcgatgacccatgattgttggtggcggaggagttcatagtggtattgccaattgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26739789 |
ggttggtagtagagctcatgtgatttgcagttgtcagcatagctgcgatgacccatgattgttggtggcggaggagttcatagtggtattgccaattgtg |
26739690 |
T |
|
| Q |
217 |
aagagaatgagatgtgacttggagaaaaagaggtcatgatgaaagaataat |
267 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
26739689 |
aagagaaagagatgtgacttggagaaaaagaggtcgtgatgaaagagtaat |
26739639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University