View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_27 (Length: 274)
Name: NF19240_high_27
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 7 - 264
Target Start/End: Complemental strand, 16441007 - 16440750
Alignment:
| Q |
7 |
gagcagaacctgtgaatagtttgatgttgtattaagactttgaggtttcaattgaggcatactagttagggagcaaaatgcattatgggcataaacgtta |
106 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16441007 |
gagctgaagctgtgaatagtttgatgttgtattaagactttgaggtttcaattgaggcatactagctagggagcaaaatgcattatgggcataaacgtta |
16440908 |
T |
 |
| Q |
107 |
cataatttcggttgtgatttcacttgggttttttggggattgaattggtagttaattaatagaatactaatttgtttcggtagaatatctaaatatgacc |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16440907 |
cataatttgggttgtgatttcacttgggttttttggggattgaattggtagttaattaatagaatactaatttgtttcagtagaatatctaaatatgacc |
16440808 |
T |
 |
| Q |
207 |
catagttccatgtggcattgaaacatatcagggaaagatgaagtgcaatgaaacatct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16440807 |
catagttccatgtggcattgaaacatatcagggaaagatgaagtgcaatgaaacatct |
16440750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University