View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_33 (Length: 244)
Name: NF19240_high_33
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 4683005 - 4682857
Alignment:
| Q |
1 |
ttatttgtcactgtgctggaattttacacactgtaaatacttgatgccattttagtcacatgatatttaaactccattagatttctttagactagaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4683005 |
ttatttgtcactgtgctggaattttacacactgtaaatacttgatgccattttagtcacatgatatttaaactccattagatttctttagactagaagtc |
4682906 |
T |
 |
| Q |
101 |
ttgcttataagatatatggactatctttatgattctgtggattctcctt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4682905 |
ttgcttataagatatatggactatctttatgattctgtggattttcctt |
4682857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 136 - 244
Target Start/End: Complemental strand, 4682640 - 4682532
Alignment:
| Q |
136 |
tgtggattctccttttctaaccagatttcttccatgcaagagtgagtgatcaaatctctttccacttgtttaaagtgtttactctcatgttacccagatc |
235 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4682640 |
tgtgaattctcctcttctaaccagatttcttccatgcaagagtgagtgatcaaatctctttccacttgtttaaagtgtttactctcatgttacccagatc |
4682541 |
T |
 |
| Q |
236 |
aatcatatt |
244 |
Q |
| |
|
||||||||| |
|
|
| T |
4682540 |
aatcatatt |
4682532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University