View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_41 (Length: 236)
Name: NF19240_high_41
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 9452433 - 9452581
Alignment:
| Q |
1 |
tatgaatttgagttctccactttggaggatatgcaaaatgcttgggctctcggcacctctaatttgaagtcgggtatcctccgtctttttcaatggacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
9452433 |
tatgaatttgagttctccactttggaggatatgcaaaacgcttgggctctaggcacctctaatttgaagtcaggcatcctccgtctttttcaatggacga |
9452532 |
T |
|
| Q |
101 |
aggactttaacccttatatgcattaccaaactcatctcaagtttggata |
149 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
9452533 |
aggactttaacctttatatgcattaccaaactcatcctaaatttggata |
9452581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13076693 - 13076632
Alignment:
| Q |
1 |
tatgaatttgagttctccactttggaggatatgcaaaatgcttgggctctcggcacctctaa |
62 |
Q |
| |
|
|||||||||||||||||| | || |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
13076693 |
tatgaatttgagttctcctcattagaggatatgcgcaatgcttgggctctaggcacctctaa |
13076632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 15160315 - 15160359
Alignment:
| Q |
1 |
tatgaatttgagttctccactttggaggatatgcaaaatgcttgg |
45 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15160315 |
tatgaatttaagttctccactttagaggatatgcgcaatgcttgg |
15160359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University