View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_46 (Length: 209)
Name: NF19240_high_46
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 10189556 - 10189737
Alignment:
| Q |
17 |
atcatattatgacatgcccaaagattgagttcaacgacctcatagtatcatcagaaattgggctaaaccaatgcaaaatgcatcacatactacaaactct |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10189556 |
atcatattatgacatgccccaagattgagtgcaacgacctcatagtatcatcagaaattgggctaaaccaatgcaaaatgcatcacatactacaaactct |
10189655 |
T |
 |
| Q |
117 |
gcttcctcagattctagaagtgagagctaatgtaaagatgggataaactcatttactatacatacaactcacttcatctcac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10189656 |
gcttcctcagattctagaagtgagagctaatgtaaagatgggataaactcatttactatacatacaactcacttcatatcac |
10189737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University