View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_high_9 (Length: 441)
Name: NF19240_high_9
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 17 - 329
Target Start/End: Complemental strand, 25032286 - 25031974
Alignment:
| Q |
17 |
atctacaagccttcgaattctccgacgactcacacgaagacggcaactggccaataatgttcagaaggtttgcattcttcgtcaacgccgtgctctccct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032286 |
atctacaagccttcgaattctccgacgactcatacgaagacggcaactggccaataatgttcagaaggtttgcattcttcgtcaacgccgtgctctccct |
25032187 |
T |
|
| Q |
117 |
ccatcgatcccgcgatattaaaaggtttagtctcaccagcggcatggtggatgatgactggtttcgtagcgactgcttcgacgtatgggttcgtgctgcc |
216 |
Q |
| |
|
|| ||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032186 |
ccgtcggtcccgtgatattaaaaggtttcgtctcaccagcggcatggtggatgatgactggtttcgtagcgactgcttcgacgtatgggttcgtgctgcc |
25032087 |
T |
|
| Q |
217 |
attgggcctcaacttgaagaactgtttgtttcccttgaatactgcgatgaagaccggcaagtactggttccttcttctctcctgaattgcaccaatctcg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032086 |
attgggcctcaacttgaagaactgtttgtttcccttgaatactgcgatgaagaccggcaagtactggttccttcttctctcctgaattgcaccaatctcg |
25031987 |
T |
|
| Q |
317 |
tttccctcaggta |
329 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25031986 |
tttccctcaggta |
25031974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 392 - 431
Target Start/End: Complemental strand, 25031965 - 25031926
Alignment:
| Q |
392 |
tatggttgctttcatgatttcatctcttgttctctctctg |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031965 |
tatggttgctttcatgatttcatctcttgttctctctctg |
25031926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 290 - 329
Target Start/End: Original strand, 20505315 - 20505354
Alignment:
| Q |
290 |
cttctctcctgaattgcaccaatctcgtttccctcaggta |
329 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20505315 |
cttccctcttgaattgcaccaatctcgtttccctcaggta |
20505354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University