View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_low_36 (Length: 240)
Name: NF19240_low_36
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 84 - 224
Target Start/End: Complemental strand, 4682514 - 4682374
Alignment:
| Q |
84 |
caaatatctcgtaatcatacaatattttaaaaaccaaatcgaacatgagatgggtaagatctatgagttatatatagttcaactgatttacactgggatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
4682514 |
caaatatctcgtaatcatacaatatttcaaaaaccaaatcgaacatgagatgggtaagatctatgagttatatatagttcaactgatttaaatcgggatg |
4682415 |
T |
 |
| Q |
184 |
aaatcacgaacaaacctctatagtgaagttcggttcaaagt |
224 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||| ||||| |
|
|
| T |
4682414 |
aaatcacgatcaaacctctatagtgatgtttggttgaaagt |
4682374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University