View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19240_low_40 (Length: 237)
Name: NF19240_low_40
Description: NF19240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19240_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 31647212 - 31647013
Alignment:
| Q |
26 |
tgctttctggtcagtgaaacatctttcgtggatgacaggaaattctagaagcaatgcaagcaatatgtactttgcaaaatttcttgaaagtgtgctaatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31647212 |
tgctttctggtcagtgaaacatctttcgtggatgacaggaaattctagaagcaatgcaagcaatatgtactttgcaaaatttcttgaaagtgtgctaatg |
31647113 |
T |
 |
| Q |
126 |
ctccttgtccttgttaagaccataattactgcagaataatagacatctttctgtggagtgactgggagagaaacttaa-aaaacatgatatggattctgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31647112 |
ctccttgtccttgttaagaccataattactgcagaataatagacatctttctgtggagtgactgggagagaaacttaaaaaaacatgatatggattctgt |
31647013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University