View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_high_31 (Length: 264)
Name: NF19242_high_31
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 30440832 - 30440712
Alignment:
| Q |
12 |
aaaggggtagataaagggacctgggtgtctattatagcgcacccagacaaaggttttttcctctctttcgctctaactataaattttggaaaaagagttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30440832 |
aaaggggtagataaagggacctgggtgtctatcacagcgcacccagacaaaggttttttcctctctttcgctctaactataaatcttggaaaaagagttt |
30440733 |
T |
 |
| Q |
112 |
atttcgcgtatgaggttgtcc |
132 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30440732 |
atttcgcgtatgaggttgtcc |
30440712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 182 - 248
Target Start/End: Complemental strand, 30440710 - 30440644
Alignment:
| Q |
182 |
ttttattggaacgatgagctcgcatctatgataggatatgtcttcgctctgcttttgaagtatgaaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30440710 |
ttttattggaacgatgagctcgcatccatgataggatatgacttcgctctgcttttgaagtatgaaa |
30440644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University