View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_high_37 (Length: 246)
Name: NF19242_high_37
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 309956 - 310179
Alignment:
| Q |
18 |
caatgggtgtatgcttgccctccttgtgagacaacttttgcttcttggatttgctttgtctattgattcggtgcttatgaccctgactggaagaaacaag |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
309956 |
caatgggcgtatgcttgccctccttgtgagacaacttttgcttcttggatttgctttgtctattgattcggtgcttctgaccctgactggaagaaacaag |
310055 |
T |
 |
| Q |
118 |
attaatcacataaaataccttaaacagaaaatgttaagtcacactcggtctaattcacatcccactattttgttgcaattgtaaaaaccacaacaaatgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
310056 |
attaatcacataaaataccttaaacagaaaatgttaagtcatactcggtctaattcacatcccactattttgttgcaattgtaaaaaccatgacaaatgg |
310155 |
T |
 |
| Q |
218 |
taagaggtatatattttacctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
310156 |
taagaggtatatattttacctttg |
310179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University