View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_low_30 (Length: 276)
Name: NF19242_low_30
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_low_30 |
 | |
|
| [»] scaffold0050 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 82 - 274
Target Start/End: Original strand, 74291 - 74483
Alignment:
| Q |
82 |
gttctttattgagggcactaagtcccccatccgggtttcccctggccacaaggttgattgtataggatactttggatcagtctagaagcttctagatgcc |
181 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
74291 |
gttctttatggagggcgctaagtcccccatccgggtttccctgggccacaaggttgatcgtataggatactttggagcattatagaagcttctagatgcc |
74390 |
T |
|
| Q |
182 |
tgttgaggcggtgctcttaggttggcgcgcccaaggctatgtgggcccttctggtgggcatttgtgcccttaattacatattgatggttcaca |
274 |
Q |
| |
|
|||||||| || | |||||| |||| ||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
74391 |
tgttgaggtggcacccttaggagggcgtgcccaaggccgtttggacccttctggagggcatttgtgcccttaattacatattgacggtccaca |
74483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 73798 - 73866
Alignment:
| Q |
1 |
agtaatggaaatatattcttcgaggagnnnnnnnttgtaaattcgattgagaaattattatttgctttt |
69 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
73798 |
agtaatggaaatatattctacgaggagaaaaaaattgtaaattcgattgagaaattattatttgctttt |
73866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 119
Target Start/End: Original strand, 7622657 - 7622697
Alignment:
| Q |
79 |
atcgttctttattgagggcactaagtcccccatccgggttt |
119 |
Q |
| |
|
||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7622657 |
atcgtcctttatagagggcactacgtcccccatccgggttt |
7622697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University