View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19242_low_32 (Length: 264)

Name: NF19242_low_32
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19242_low_32
NF19242_low_32
[»] chr6 (2 HSPs)
chr6 (12-132)||(30440712-30440832)
chr6 (182-248)||(30440644-30440710)


Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 30440832 - 30440712
Alignment:
12 aaaggggtagataaagggacctgggtgtctattatagcgcacccagacaaaggttttttcctctctttcgctctaactataaattttggaaaaagagttt 111  Q
    |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
30440832 aaaggggtagataaagggacctgggtgtctatcacagcgcacccagacaaaggttttttcctctctttcgctctaactataaatcttggaaaaagagttt 30440733  T
112 atttcgcgtatgaggttgtcc 132  Q
    |||||||||||||||||||||    
30440732 atttcgcgtatgaggttgtcc 30440712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 182 - 248
Target Start/End: Complemental strand, 30440710 - 30440644
Alignment:
182 ttttattggaacgatgagctcgcatctatgataggatatgtcttcgctctgcttttgaagtatgaaa 248  Q
    |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||    
30440710 ttttattggaacgatgagctcgcatccatgataggatatgacttcgctctgcttttgaagtatgaaa 30440644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University