View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_low_37 (Length: 247)
Name: NF19242_low_37
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 267507 - 267273
Alignment:
| Q |
1 |
cttgtggcgagcgtagcgtgagtgtaggttggactttgaacttgacattgtgtttgcttcactgtgattgacatgatatgatatgatagagagataatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267507 |
cttgtggcgagcgtagcgtgagtgtaggttggactttgaacttgacattgtgtttgcttcattgtgattgacatgatatgatatgatagagagataatta |
267408 |
T |
 |
| Q |
101 |
tagcacaccacgaagtgaacaacctggcttggacaaattgcgcttttcgtttttggtaaagcaagattaatttgaaccgaaaacaagataaacaacctgt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267407 |
tagcacaccaagaagtgaacaacctggcttggacaaattgcgcttttcgtttttggtaaagcaagattaatttgaaccgaaaacaagataaacaacctgt |
267308 |
T |
 |
| Q |
201 |
tagaaactttaaattaagttaaaagaccgttgatg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
267307 |
tagaaactttaaattaagttaaaagaccgttgatg |
267273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University