View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_low_39 (Length: 238)
Name: NF19242_low_39
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 33196944 - 33196730
Alignment:
| Q |
1 |
agcttgaagaatacaaaagaagagagatattgggagtgtatgtaataagagagattccggtttctatcatggctcagataaagaggtctccattcacccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33196944 |
agcttgaagaatacaaaagaagagagatattgggagtgtatgtaataagagagattccggtttctatcatggctcagataaagaggtctccattcacccc |
33196845 |
T |
 |
| Q |
101 |
actcctaaagaaaaagaaaaagtgtgtctaggaattgaaggatgtgatttttcatttgtgggaatattagtggaggatcttctatcttctctatggtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33196844 |
actcctaaagaaaaagaaaaagtgtgtctaggaattgaaggatgtgatttttcatttgtgggaatattagtggaggatcttctatcttctctatggtata |
33196745 |
T |
 |
| Q |
201 |
gtggcacatataaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33196744 |
gtggcacatataaat |
33196730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University