View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19242_low_41 (Length: 235)
Name: NF19242_low_41
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19242_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 42224855 - 42225004
Alignment:
| Q |
16 |
cacagacagtaaagaggaacactttgagtttgagtactgttaacgcaatgattattaaagtaaacacaataagaacaaaagtttctgtggccaaagctta |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42224855 |
cacaaacagtaaagaggaacactttgagtttgagtactgttaacgcaatgattattaaagtaaacacaataagaacaaaagtttatgtggccaaagctta |
42224954 |
T |
 |
| Q |
116 |
gtgtcacgcgagagagcataaaatcataccgttaataattcgatgtgacg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224955 |
gtgtcacgcgagagagcataaaatcataccgttaataattcgatgtgacg |
42225004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University