View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19242_low_41 (Length: 235)

Name: NF19242_low_41
Description: NF19242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19242_low_41
NF19242_low_41
[»] chr7 (1 HSPs)
chr7 (16-165)||(42224855-42225004)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 42224855 - 42225004
Alignment:
16 cacagacagtaaagaggaacactttgagtttgagtactgttaacgcaatgattattaaagtaaacacaataagaacaaaagtttctgtggccaaagctta 115  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
42224855 cacaaacagtaaagaggaacactttgagtttgagtactgttaacgcaatgattattaaagtaaacacaataagaacaaaagtttatgtggccaaagctta 42224954  T
116 gtgtcacgcgagagagcataaaatcataccgttaataattcgatgtgacg 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
42224955 gtgtcacgcgagagagcataaaatcataccgttaataattcgatgtgacg 42225004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University