View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19243_low_9 (Length: 227)
Name: NF19243_low_9
Description: NF19243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19243_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 136
Target Start/End: Original strand, 22016230 - 22016363
Alignment:
| Q |
7 |
tttatgacaggttttgat---tgtagttaagcccactagtaagaaaaggttttgttgttgttcagttgttttccctcctagcatatacataccgtgttgg |
103 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
22016230 |
tttaagacaggttttgatggctgtagttaagccgactagtgagaaaaggttttgttgttgttcagttgttttccctcctagcatgtacgtactgtgttgg |
22016329 |
T |
 |
| Q |
104 |
-aaaagctgcctgagtttcaatccacctctagct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22016330 |
aaaaagctgcctgagtttcaatccacctctagct |
22016363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 134 - 219
Target Start/End: Original strand, 22016398 - 22016483
Alignment:
| Q |
134 |
gcttcctctagtatctttgttgtgctggtgtgaagagtgtgttttgactttagtttcacatcctctagaaatatggctttaatagt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22016398 |
gcttcctctagtatctttgttgtgctggtgtgaagagtgtgttttgactttagtttcacatcatctagaaatatggctttaatagt |
22016483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University