View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19246_high_10 (Length: 275)
Name: NF19246_high_10
Description: NF19246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19246_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 31 - 156
Target Start/End: Complemental strand, 16358445 - 16358318
Alignment:
| Q |
31 |
gcattagcatccatttatctttt--atatagtacatctaaatctaaaggcaatgctcctcaatttcaacatgggaaacaaagtagctgaattgttacctt |
128 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16358445 |
gcattagcatccatttatcttttttatatagtacatctaaatctaaaggcaatgctcctcaatttcaacatgggaaacaaagtagctgaattgttacctt |
16358346 |
T |
 |
| Q |
129 |
ctggagcccatgttttatattcccttaa |
156 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16358345 |
ctggagcccatgttttatattcccttaa |
16358318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University