View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19247_low_10 (Length: 334)
Name: NF19247_low_10
Description: NF19247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19247_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 167 - 318
Target Start/End: Complemental strand, 34683485 - 34683334
Alignment:
| Q |
167 |
acaatttcactaagcaaagaaacaactgtgaccacttgaattaattctattattgggatttcgagttttgcatcaccatcttttgcannnnnnngtgtgt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34683485 |
acaatttcactaagcaaagaaacaactgtgaccacttgaattaattctattattgggatttcgagttttgcatcaccatcttttgcatttttttgtgtgt |
34683386 |
T |
|
| Q |
267 |
ttggataagattttaataaattctgaagctctagggctgcattattcatctc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683385 |
ttggataagattttaataaattctgaagctctagggctgcattattcatctc |
34683334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 171 - 244
Target Start/End: Complemental strand, 34699715 - 34699642
Alignment:
| Q |
171 |
tttcactaagcaaagaaacaactgtgaccacttgaattaattctattattgggatttcgagttttgcatcacca |
244 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||| ||| |||||||||||||| | ||||||||||||| |
|
|
| T |
34699715 |
tttcaataagcaaagaaattaccgtgaccacttgaattacttccattattgggatttccatttttgcatcacca |
34699642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22922070 - 22922023
Alignment:
| Q |
1 |
atcactctttgtacgataaaagtatgtggaataatatttggtatcttg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22922070 |
atcactctttgtacgataaaagtatgtgcaataatatttggtatcttg |
22922023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University