View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19247_low_16 (Length: 255)
Name: NF19247_low_16
Description: NF19247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19247_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 43443797 - 43444047
Alignment:
| Q |
1 |
ttctatcttccagttcatgatatatctcattttccaattttatgtcaacattttgttttagattcctcttcaaatatgaattat------catagtttat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43443797 |
ttctatcttccagttcatgatatatctcattttccaattttatgtgaacattttgttttagattcctcttcaaatatgaattatatctctcatagtttat |
43443896 |
T |
 |
| Q |
95 |
taattaaacaaatatcccttnnnnnnn-ttacagagcttagaatgtgtaccaatctatgaacaacccactttcttgtaatttgtccatagacaggggaag |
193 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43443897 |
taattaaacaaacatcccttaaaaaaaattacagagcttagaatgtgtaccaatctatgaacaacccactttcttgtaatttgtccatagataggggaag |
43443996 |
T |
 |
| Q |
194 |
tgaatttcatttggaggaagaataaagtgtgtggaccatcgctgccttcat |
244 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43443997 |
tgaatttcatttggaggaagattaaagtgtgtggaccatcgctgccttcat |
43444047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University