View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19247_low_23 (Length: 234)
Name: NF19247_low_23
Description: NF19247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19247_low_23 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 75 - 234
Target Start/End: Original strand, 4775009 - 4775168
Alignment:
| Q |
75 |
tgattttaaaatcgaacctgagtttgaattggtgaaacttctcaaccatgatttgattgctttagttgattcaataacatttcaatgggagaagtaataa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775009 |
tgattttaaaatcgaacctgagtttgaattggtgaaacttctcaaccatgacttgattgctttagttgattcaataacatttcaatgggagaagtaataa |
4775108 |
T |
 |
| Q |
175 |
atcatcatctgacctaaaatttatacacagactgacctaagattttatttgagcataata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4775109 |
atcatcatctgacctaaaatttatacactgactgacctaagattttatttgagcataata |
4775168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 4774861 - 4774915
Alignment:
| Q |
1 |
cattgtgtcgaatattattggacttgcaataatatatgatatagatgactttgaa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774861 |
cattgtgtcgaatattattggacttgcaataatatatgatatagatgactttgaa |
4774915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University