View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19247_low_25 (Length: 216)
Name: NF19247_low_25
Description: NF19247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19247_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 41378306 - 41378128
Alignment:
| Q |
19 |
ataatgccaccattattgtaacaaaagataaggacaagacaagccaagtttaacttatttagcaaagaaaatccaaaactgtcaagactaaatatcaaat |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41378306 |
ataacgccaccattattgtaacaaaagataaggacaagacaagccaagtttaacttatttagcaaagaaaatccaaaactgtcaaaactaaatatcaaac |
41378207 |
T |
 |
| Q |
119 |
tctatatcgagtttagcaaaccccacaacacattaacaaatacaaagattagcaatttaatgattaggaatgttaaaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41378206 |
tctatatcgagtttagcaaaccccacaacacattaacaaatacaaagattagcaatttaatgattaggaatgttaaaac |
41378128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University