View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19248_high_6 (Length: 264)
Name: NF19248_high_6
Description: NF19248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19248_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 46 - 254
Target Start/End: Original strand, 50717819 - 50718027
Alignment:
| Q |
46 |
gcttaacattgctattggtgacacaaggacattgacttagctaaataattctttttcgtgtgttgtgtttttacctaatagctaggcactatggagggac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50717819 |
gcttaacattgctattggtgacacaaggacattgacttagctaaataattctttttcgtgtgttgtgtttttacctaatagctaggcactatggagggac |
50717918 |
T |
 |
| Q |
146 |
atgaaattttagggtttgctttctttgtaattggtttatggcaccttttcaacaacataaaggtccactttctatgttatactttcaagtcctacacatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50717919 |
atgaaattttagggtttgctttctttgtaattggtttatggcaccttttcaacaacataaagctccactttctatgttatactttcaagtcctacacatc |
50718018 |
T |
 |
| Q |
246 |
aaccctatg |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
50718019 |
aaccctatg |
50718027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University