View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19248_high_8 (Length: 243)
Name: NF19248_high_8
Description: NF19248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19248_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 10076609 - 10076755
Alignment:
| Q |
18 |
gttgttagctggattatgctaagctagttgacttaatgatattttgcagatattgtggcgaatgccactgtcttaaaataaaatatgtatcttgttgggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
10076609 |
gttgttagctggattatgctaagctagttgacttgatgatattttgcagatattgtggcgaatgctactgtcttaaaataaaatatgtattttgttgggg |
10076708 |
T |
|
| Q |
118 |
gaaaataagtattatttacagcctgcatgtacacactctacctataa |
164 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10076709 |
gaaaataagtattatttacagcctgcctgtacacactctacctataa |
10076755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 10084848 - 10084930
Alignment:
| Q |
19 |
ttgttagctggattatgctaagctagttgacttaatgatattttgcagatattgtggcgaatgccactgtcttaaaataaaat |
101 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| || | |||||| || ||||| |||||||| || ||||||||||| |
|
|
| T |
10084848 |
ttgttagctggattgtgctaaactagttgacttaatgacatgtagcagattttatggcgcatgccactctcctaaaataaaat |
10084930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University