View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1924_high_11 (Length: 238)
Name: NF1924_high_11
Description: NF1924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1924_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 175584 - 175383
Alignment:
| Q |
22 |
caatcaatgttctcttttgtttcttttcatcttatttatttaattgcaactaatcatttcatcatctgtgactttaggaatccagtttggttcgtttggt |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
175584 |
caatcaatattctcttttgtttcttttcatcttatttatttaattgcaactaatcatttcatcatctgttactttaggaatccagtttggttcgtttggt |
175485 |
T |
|
| Q |
122 |
tatgaatgcaatgttaggttccaaatcatccatcatcgctatccataacctatctcccatcttttcttctcatcatcccaacaccactttccttcatctc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175484 |
tatgaatgcaatgttaggttccaaatcatccatcatcgctatccataacctatctcccatcttttcttctcatcatcccaacaccactttccttcatctc |
175385 |
T |
|
| Q |
222 |
tg |
223 |
Q |
| |
|
|| |
|
|
| T |
175384 |
tg |
175383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University