View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1924_low_13 (Length: 218)
Name: NF1924_low_13
Description: NF1924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1924_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 40588983 - 40589146
Alignment:
| Q |
20 |
cttgaagttgtatactgcaaattcctcctctcatgatcttcgnnnnnnntattagttatttggtttgaaaaannnnnnnnnnnntagaaaacaaaggcta |
119 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40588983 |
cttgaagctgtatactacaaattcctcctctcatgatcttcgaaaaaaatattagttatttggtttgaaaaaagagagagagagtagaaaacaaaggcta |
40589082 |
T |
|
| Q |
120 |
actagttggtttggtacaattagagcaagatgtggaagatatagatataatgtgagaattttgt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40589083 |
actagttggtttggtacaattagagcaagatgtggaagatatagatataatgtgagaattttgt |
40589146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 178 - 218
Target Start/End: Complemental strand, 175570 - 175530
Alignment:
| Q |
178 |
ttttgtttcttttcatattatttatttaattgcaactaatc |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
175570 |
ttttgtttcttttcatcttatttatttaattgcaactaatc |
175530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University