View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19250_high_5 (Length: 394)

Name: NF19250_high_5
Description: NF19250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19250_high_5
NF19250_high_5
[»] chr5 (1 HSPs)
chr5 (339-377)||(1050481-1050519)


Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 339 - 377
Target Start/End: Complemental strand, 1050519 - 1050481
Alignment:
339 agaaatatgccaaagagattttaacaaggtttagcatgg 377  Q
    |||||||||||||||||||||||||||||||||||||||    
1050519 agaaatatgccaaagagattttaacaaggtttagcatgg 1050481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University