View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_high_12 (Length: 336)
Name: NF19251_high_12
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 95 - 173
Target Start/End: Original strand, 56241621 - 56241699
Alignment:
| Q |
95 |
ggcaatttggtggttttcaaaaaccaaaccggttcaatcattaagcaaatagaagtggaattgcagtttaataatttga |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56241621 |
ggcaatttggtggttttcaaaaaccaaaccggttcaatcattaagcaaatagaagtggaattgcagtttaataatttga |
56241699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 237 - 304
Target Start/End: Original strand, 56241775 - 56241843
Alignment:
| Q |
237 |
aagaatcaataatgaagagctgg-tgacgtttaaggtgagaaagtgacttagtgtgttattgatatagc |
304 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56241775 |
aagaatcaataatgaagagctgggtgacgtttaaggtgagaaagtgacttagtgtgttattgatatagc |
56241843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 56241545 - 56241592
Alignment:
| Q |
47 |
aaaggaaaatattttatccatgtgtcatgttttatttcgataacggtt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56241545 |
aaaggaaaatattttatccatgtgtcatgttttatttcgataacggtt |
56241592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 9 - 49
Target Start/End: Original strand, 56241475 - 56241515
Alignment:
| Q |
9 |
agcaaaggactcactctctctagtttcttcttctgcacaaa |
49 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56241475 |
agcaaatgactcactctctctagtttcttcttctgcacaaa |
56241515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 193 - 228
Target Start/End: Original strand, 56241710 - 56241745
Alignment:
| Q |
193 |
gaatctatctcacaaatcttgagtatgctatccatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56241710 |
gaatctatctcacaaatcttgagtatgctctccatg |
56241745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University